Apolipoprotein A V (APOA5) (NM_001166598) Human Untagged Clone
CAT#: SC328590
APOA5 (untagged)-Human apolipoprotein A-V (APOA5) transcript variant 2
CNY 7,220.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | APOAV; RAP3 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001166598, the custom clone sequence may differ by one or more nucleotides
ATGGCAAGCATGGCTGCCGTGCTCACCTGGGCTCTGGCTCTTCTTTCAGCGTTTTCGGCC ACCCAGGCACGGAAAGGCTTCTGGGACTACTTCAGCCAGACCAGCGGGGACAAAGGCAGG GTGGAGCAGATCCATCAGCAGAAGATGGCTCGCGAGCCCGCGACCCTGAAAGACAGCCTT GAGCAAGACCTCAACAATATGAACAAGTTCCTGGAAAAGCTGAGGCCTCTGAGTGGGAGC GAGGCTCCTCGGCTCCCACAGGACCCGGTGGGCATGCGGCGGCAGCTGCAGGAGGAGTTG GAGGAGGTGAAGGCTCGCCTCCAGCCCTACATGGCAGAGGCGCACGAGCTGGTGGGCTGG AATTTGGAGGGCTTGCGGCAGCAACTGAAGCCCTACACGATGGATCTGATGGAGCAGGTG GCCCTGCGCGTGCAGGAGCTGCAGGAGCAGTTGCGCGTGGTGGGGGAAGACACCAAGGCC CAGTTGCTGGGGGGCGTGGACGAGGCTTGGGCTTTGCTGCAGGGACTGCAGAGCCGCGTG GTGCACCACACCGGCCGCTTCAAAGAGCTCTTCCACCCATACGCCGAGAGCCTGGTGAGC GGCATCGGGCGCCACGTGCAGGAGCTGCACCGCAGTGTGGCTCCGCACGCCCCCGCCAGC CCCGCGCGCCTCAGTCGCTGCGTGCAGGTGCTCTCCCGGAAGCTCACGCTCAAGGCCAAG GCCCTGCACGCACGCATCCAGCAGAACCTGGACCAGCTGCGCGAAGAGCTCAGCAGAGCC TTTGCAGGCACTGGGACTGAGGAAGGGGCCGGCCCGGACCCCCAGATGCTCTCCGAGGAG GTGCGCCAGCGACTTCAGGCTTTCCGCCAGGACACCTACCTGCAGATAGCTGCCTTCACT CGCGCCATCGACCAGGAGACTGAGGAGGTCCAGCAGCAGCTGGCGCCACCTCCACCAGGC CACAGTGCCTTCGCCCCAGAGTTTCAACAAACAGACAGTGGCAAGGTTCTGAGCAAGCTG CAGGCCCGTCTGGATGACCTGTGGGAAGACATCACTCACAGCCTTCATGACCAGGGCCAC AGCCATCTGGGGGACCCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001166598 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001166598.1, NP_001160070.1 |
RefSeq Size | 1930 bp |
RefSeq ORF | 1101 bp |
Locus ID | 116519 |
UniProt ID | Q6Q788 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | PPAR signaling pathway |
Gene Summary | The protein encoded by this gene is an apolipoprotein that plays an important role in regulating the plasma triglyceride levels, a major risk factor for coronary artery disease. It is a component of high density lipoprotein and is highly similar to a rat protein that is upregulated in response to liver injury. Mutations in this gene have been associated with hypertriglyceridemia and hyperlipoproteinemia type 5. This gene is located proximal to the apolipoprotein gene cluster on chromosome 11q23. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Oct 2009] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229952 | APOA5 (Myc-DDK-tagged)-Human apolipoprotein A-V (APOA5), transcript variant 2 |
CNY 3,656.00 |
|
RC229952L3 | Lenti-ORF clone of APOA5 (Myc-DDK-tagged)-Human apolipoprotein A-V (APOA5), transcript variant 2 |
CNY 5,890.00 |
|
RC229952L4 | Lenti-ORF clone of APOA5 (mGFP-tagged)-Human apolipoprotein A-V (APOA5), transcript variant 2 |
CNY 5,890.00 |
|
RG229952 | APOA5 (tGFP-tagged) - Human apolipoprotein A-V (APOA5), transcript variant 2 |
CNY 4,370.00 |