TIM 1 (HAVCR1) (NM_001173393) Human Untagged Clone
CAT#: SC328585
HAVCR1 (untagged)-Human hepatitis A virus cellular receptor 1 (HAVCR1) transcript variant 3
CNY 7,220.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD365; HAVCR; HAVCR-1; KIM-1; KIM1; TIM; TIM-1; TIM1; TIMD-1; TIMD1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001173393, the custom clone sequence may differ by one or more nucleotides
ATGCATCCTCAAGTGGTCATCTTAAGCCTCATCCTACATCTGGCAGATTCTGTAGCTGGT TCTGTAAAGGTTGGTGGAGAGGCAGGTCCATCTGTCACACTACCCTGCCACTACAGTGGA GCTGTCACATCCATGTGCTGGAATAGAGGCTCATGTTCTCTATTCACATGCCAAAATGGC ATTGTCTGGACCAATGGAACCCACGTCACCTATCGGAAGGACACACGCTATAAGCTATTG GGGGACCTTTCAAGAAGGGATGTCTCTTTGACCATAGAAAATACAGCTGTGTCTGACAGT GGCGTATATTGTTGCCGTGTTGAGCACCGTGGGTGGTTCAATGACATGAAAATCACCGTA TCATTGGAGATTGTGCCACCCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACC GTCACGACTGTTCGAACGAGCACCACTGTTCCAACGACAACGACTGTTCCAATGACGACT GTTCCAACGACAACTGTTCCAACAACAATGAGCATTCCAACGACAACGACTGTTCTGACG ACAATGACTGTTTCAACGACAACGAGCGTTCCAACGACAACGAGCATTCCAACAACAACA AGTGTTCCAGTGACAACAACTGTCTCTACCTTTGTTCCTCCAATGCCTTTGCCCAGGCAG AACCATGAACCAGTAGCCACTTCACCATCTTCACCTCAGCCAGCAGAAACCCACCCTACG ACACTGCAGGGAGCAATAAGGAGAGAACCCACCAGCTCACCATTGTACTCTTACACAACA GATGGGAATGACACCGTGACAGAGTCTTCAGATGGCCTTTGGAATAACAATCAAACTCAA CTGTTCCTAGAACATAGTCTACTGACGGCCAATACCACTAAAGGAATCTATGCTGGAGTC TGTATTTCTGTCTTGGTGCTTCTTGCTCTTTTGGGTGTCATCATTGCCAAAAAGTATTTC TTCAAAAAGGAGGTTCAACAACTAAGTGTTTCATTTAGCAGCCTTCAAATTAAAGCTTTG CAAAATGCAGTTGAAAAGGAAGTCCAAGCAGAAGACAATATCTACATTGAGAATAGTCTT TATGCCACGGACTAA |
Restriction Sites | Please inquire |
ACCN | NM_001173393 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001173393.1, NP_001166864.1 |
RefSeq Size | 1359 bp |
RefSeq ORF | 1095 bp |
Locus ID | 26762 |
UniProt ID | Q96D42 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | The protein encoded by this gene is a membrane receptor for both human hepatitis A virus (HHAV) and TIMD4. The encoded protein may be involved in the moderation of asthma and allergic diseases. The reference genome represents an allele that retains a MTTVP amino acid segment that confers protection against atopy in HHAV seropositive individuals. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 4, 12 and 19. [provided by RefSeq, Apr 2015] Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Both variants 1 and 3 encode isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229947 | HAVCR1 (Myc-DDK-tagged)-Human hepatitis A virus cellular receptor 1 (HAVCR1), transcript variant 3 |
CNY 3,656.00 |
|
RC229947L3 | Lenti-ORF clone of HAVCR1 (Myc-DDK-tagged)-Human hepatitis A virus cellular receptor 1 (HAVCR1), transcript variant 3 |
CNY 5,890.00 |
|
RC229947L4 | Lenti-ORF clone of HAVCR1 (mGFP-tagged)-Human hepatitis A virus cellular receptor 1 (HAVCR1), transcript variant 3 |
CNY 5,890.00 |
|
RG229947 | HAVCR1 (tGFP-tagged) - Human hepatitis A virus cellular receptor 1 (HAVCR1), transcript variant 3 |
CNY 4,370.00 |