NIPA2 (NM_001184889) Human Untagged Clone
CAT#: SC328575
NIPA2 (untagged)-Human non imprinted in Prader-Willi/Angelman syndrome 2 (NIPA2) transcript variant 5
CNY 7,220.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | SLC57A2 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001184889, the custom clone sequence may differ by one or more nucleotides
ATGAGCCAGGGGCGTGGAAAATATGACTTCTATATTGGTCTGGGATTGGCTATGAGCTCC AGCATTTTCATTGGAGGAAGTTTCATTTTGAAAAAAAAGGGCCTCCTTCGACTTGCCAGG AAAGGCTCTATGAGAGCAGGTCAAGGTGGCCATGCATATCTTAAGGAATGGTTGTGGTGG GCTGGACTGCTGTCAATGGGAGCTGGTGAGGTGGCCAACTTCGCTGCGTATGCGTTTGCA CCAGCCACTCTAGTGACTCCACTAGGAGCTCTCAGCGTGCTAGTAAGTGCCATTCTTTCT TCATACTTTCTCAATGAAAGACTTAATCTTCATGGGAAAATTGGGTGTTTGCTAAGTATT CTAGGATCTACAGTTATGGTCATTCATGCTCCAAAGGAAGAGGAGATTGAGACTTTAAAT GAAATGTCTCACAAGCTAGGTGATCCAGGTTTTGTGGTCTTTGCAACCCTTGTGGTCATT GTGGCCTTGATATTAATCTTCGTGGTGGGTCCTCGCCATGGACAGACAAACATTCTTGTG TACATAACAATCTGCTCTGTAATCGGCGCGTTTTCAGTCTCCTGTGTGAAGGGCCTGGGC ATTGCTATCAAGGAGCTGTTTGCAGGGAAGCCTGTGCTGCGGCATCCCCTGGCTTGGATT CTGCTGCTGAGCCTCATCGTCTGTGTGAGCACACAGATTAATTACCTAAATAGGGCCCTG GATATATTCAACACTTCCATTGTGACTCCAATATATTATGTATTCTTTACAACATCAGTT TTAACTTGTTCAGCTATTCTTTTTAAGGAGTGGCAAGATATGCCTGTTGACGATGTCATT GGTACTTTGAGTGGCTTCTTTACAATCATTGTGGGGATATTCTTGTTGCATGCCTTTAAA GACGTCAGCTTTAGTCTAGCAAGTCTGCCTGTGTCTTTTCGAAAAGACGAGAAAGCAATG AATGGCAATCTCTCTAATATGTATGAAGTTCTTAATAATAATGAAGAAAGCTTAACCTGT GGAATCGAACAACACACTGGTGAAAATGTCTCCCGAAGAAATGGAAATCTGACAGCTTTT TAA |
Restriction Sites | Please inquire |
ACCN | NM_001184889 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001184889.1, NP_001171818.1 |
RefSeq Size | 3477 bp |
RefSeq ORF | 1083 bp |
Locus ID | 81614 |
UniProt ID | Q8N8Q9 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a possible magnesium transporter. This gene is located adjacent to the imprinted domain in the Prader-Willi syndrome deletion region of chromosome 15. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 7 and 21.[provided by RefSeq, May 2010] Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3 and 4 encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229937 | NIPA2 (Myc-DDK-tagged)-Human non imprinted in Prader-Willi/Angelman syndrome 2 (NIPA2), transcript variant 5 |
CNY 3,656.00 |
|
RC229937L3 | Lenti-ORF clone of NIPA2 (Myc-DDK-tagged)-Human non imprinted in Prader-Willi/Angelman syndrome 2 (NIPA2), transcript variant 5 |
CNY 5,890.00 |
|
RC229937L4 | Lenti-ORF clone of NIPA2 (mGFP-tagged)-Human non imprinted in Prader-Willi/Angelman syndrome 2 (NIPA2), transcript variant 5 |
CNY 5,890.00 |
|
RG229937 | NIPA2 (tGFP-tagged) - Human non imprinted in Prader-Willi/Angelman syndrome 2 (NIPA2), transcript variant 5 |
CNY 4,370.00 |