SSH3BP1 (ABI1) (NM_001178125) Human Untagged Clone

CAT#: SC328532

ABI1 (untagged)-Human abl-interactor 1 (ABI1) transcript variant 12



  "NM_001178125" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (4)
ABI1 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ABI-1; ABLBP4; E3B1; NAP1BP; SSH3BP; SSH3BP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328532 representing NM_001178125.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAGAGCTGCAGATGTTACTAGAGGAGGAGATCCCGTCTGGCAAGAGGGCGCTGATCGAGAGTTAC
CAGAACCTGACTCGGGTGGCAGACTACTGTGAAAACAACTACATACAGGCTACAGACAAGAGAAAAGCT
TTAGAGGAGACCAAAGCCTATACAACCCAATCTCTAGCTAGTGTTGCTTATCAAATAAATGCATTGGCC
AACAATGTACTCCAGTTGCTGGATATCCAAGCCTCTCAGCTTCGGAGAATGGAGTCTTCCATCAATCAT
ATCTCACAGCATGGAAATAACCAGCCTGCAAGAACTGGCACACTGTCGAGAACAAATCCTCCTACTCAG
AAACCGCCAAGTCCTCCCATGTCAGGCCGGGGAACACTGGGACGGAATACTCCTTATAAAACCCTGGAA
CCTGTTAAACCCCCAACAGTTCCTAATGACTATATGACCAGTCCTGCTAGGCTTGGAAGTCAGCATAGT
CCAGGCAGGACAGCATCTTTAAATCAGAGACCAAGGACACACAGTGGAAGTAGTGGAGGAAGTGGAAGT
CGAGAAAACAGTGGTAGCAGTAGTATTGGCATTCCCATTGCTGTGCCTACACCTTCGCCACCCACTATT
GGACCAGTTGCTGATAGTCCAACTCCACCGCCACCACCTCCACCAGATGACATTCCCATGTTTGATGAC
TCTCCACCTCCCCCACCACCACCACCAGTGGATTATGAAGATGAGGAGGCTGCAGTAGTTCAGTATAAT
GATCCATATGCAGATGGGGATCCTGCTTGGGCCCCCAAGAATTATATTGAGAAAGTTGTTGCAATATAT
GATTATACAAAAGACAAGGATGATGAGCTGTCATTTATGGAGGGTGCAATCATTTATGTTATAAAGAAG
AATGATGATGGCTGGTATGAAGGAGTCTGCAATCGAGTGACTGGTCTGTTCCCTGGGAACTATGTTGAA
TCAATCATGCACTATACTGATTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001178125
Insert Size 990 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001178125.1
RefSeq Size 3188 bp
RefSeq ORF 990 bp
Locus ID 10006
UniProt ID Q8IZP0
MW 35.9 kDa
Gene Summary This gene encodes a member of the Abelson-interactor family of adaptor proteins. These proteins facilitate signal transduction as components of several multiprotein complexes, and regulate actin polymerization and cytoskeletal remodeling through interactions with Abelson tyrosine kinases. The encoded protein plays a role in macropinocytosis as a component of the WAVE2 complex, and also forms a complex with EPS8 and SOS1 that mediates signal transduction from Ras to Rac. This gene may play a role in the progression of several malignancies including melanoma, colon cancer and breast cancer, and a t(10;11) chromosomal translocation involving this gene and the MLL gene has been associated with acute myeloid leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 14. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (12) lacks five alternate in-frame coding exons, compared to variant 1. The resulting protein (isoform l) has the same N- and C-termini but is shorter when it is compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...