p53R2 (RRM2B) (NM_001172478) Human Untagged Clone

CAT#: SC328486

RRM2B (untagged)-Human ribonucleotide reductase M2 B (TP53 inducible) (RRM2B) transcript variant 3



  "NM_001172478" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal p53R2 Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MTDPS8A; MTDPS8B; P53R2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328486 representing NM_001172478.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCGACCCGGAAAGGCCGGAAGCGGCCGGGCTGGATCAGGATGAGGTCGACTTATCAAAGGATCTC
CCTCACTGGAACAAGCTTAAAGCAGATGAGAAGTACTTCATCTCTCACATCTTAGCCTTTTTTGCAGCC
AGTGATGGAATTGTAAATGAAAATTTGGTGGAGCGCTTTAGTCAGGAGGTGCAGGTTCCAGAGGCTCGC
TGTTTCTATGGCTTTCAAATTCTCATCGAGAATGTTCACTCAGAGATGTACAGTTTGCTGATAGACACT
TACATCAGAGATCCCAAGAAAAGGGAATTTTTATTTAATGCAATTGAAACCATGCCCTATGTTAAGAAA
AAAGCAGATTGGGCCTTGCGATGGATAGCAGATAGAAAATCTACTTTTGGGGAAAGAGTGGTGGCCTTT
GCTGCTGTAGAAGGAGTTTTCTTCTCAGGATCTTTTGCTGCTATATTCTGGCTAAAGAAGAGAGGTCTT
ATGCCAGGACTCACTTTTTCCAATGAACTCATCAGCAGAGATGAAGGACTTCACTGTGACTTTGCTTGC
CTGATGTTCCAATACTTAGTAAATAAGCCTTCAGAAGAAAGGGTCAGGGAGATCATTGTTGATGCTGTC
AAAATTGAGCAGGAGTTTTTAACAGAAGCCTTGCCAGTTGGCCTCATTGGAATGAATTGCATTTTGATG
AAACAGTACATTGAGTTTGTAGCTGACAGATTACTTGTGGAACTTGGATTCTCAAAGGTTTTTCAGGCA
GAAAATCCTTTTGATTTTATGGAAAACATTTCTTTAGAAGGAAAAACAAATTTCTTTGAGAAACGAGTT
TCAGAGTATCAGCGTTTTGCAGTTATGGCAGAAACCACAGATAACGTCTTCACCTTGGATGCAGATTTT
TAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001172478
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001172478.1
RefSeq Size 4776 bp
RefSeq ORF 900 bp
Locus ID 50484
UniProt ID Q7LG56
Protein Families Druggable Genome, Transmembrane
Protein Pathways Glutathione metabolism, Metabolic pathways, p53 signaling pathway, Purine metabolism, Pyrimidine metabolism
MW 34.5 kDa
Gene Summary This gene encodes the small subunit of a p53-inducible ribonucleotide reductase. This heterotetrameric enzyme catalyzes the conversion of ribonucleoside diphosphates to deoxyribonucleoside diphosphates. The product of this reaction is necessary for DNA synthesis. Mutations in this gene have been associated with autosomal recessive mitochondrial DNA depletion syndrome, autosomal dominant progressive external ophthalmoplegia-5, and mitochondrial neurogastrointestinal encephalopathy. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. This results in a shorter protein (isoform 3), compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...