ASMT (NM_001171039) Human Untagged Clone
CAT#: SC328485
ASMT (untagged)-Human acetylserotonin O-methyltransferase (ASMT) transcript variant 3
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ASMTY; HIOMT; HIOMTY |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001171039, the custom clone sequence may differ by one or more nucleotides
ATGGGATCCTCAGAGGACCAGGCCTATCGCCTCCTTAATGACTACGCCAACGGCTTCATG GTGTCCCAGGTTCTCTTCGCCGCCTGCGAGCTGGGCGTGTTTGACCTTCTCGCCGAGGCC CCAGGGCCCCTGGACGTGGCGGCAGTGGCTGCAGGTGTGAGGGCCAGCGCCCATGGGACA GAGCTCCTGCTGGACATCTGTGTGTCCCTGAAGCTGCTGAAAGTGGAGACGAGGGGAGGA AAAGCTTTCTATCGAAACACAGAGCTGTCCAGCGACTACCTGACCACGGTCAGCCCGACG TCACAATGCAGCATGCTGAAGTACATGGGCAGGACCAGCTACCGGTGCTGGGGCCACCTG GCAGACGCCGTGAGAGAAGGAAGGAACCAGTACCTGGAGACGTTTGGCGTTCCCGCTGAA GAGCTTTTTACGGCCATCTACAGGTCCGAGGGCGAGCGGCTACAGTTCATGCAAGCTCTG CAGGAGGTCTGGAGCGTCAACGGGAGAAGCGTGCTGACCGCCTTTGACCTGTCAGTGTTC CCACTTATGTGTGACCTTGGTGGGGATTTCTTCAAAGACCCTCTTCCGGAAGCTGATCTG TACATCCTGGCCAGGGTCCTCCATGACTGGGCAGACGGAAAGTGCTCACACCTGCTGGAG AGGATCTACCACACTTGCAAGCCAGGTGGTGGCATTCTGGTAATTGAAAGCCTCCTGGAT GAAGACAGGCGAGGTCCTCTGCTCACGCAGCTCTACTCTCTGAACATGCTTGTGCAGACG GAAGGGCAGGAGAGGACCCCCACCCACTACCACATGCTCCTCTCTTCTGCTGGCTTCAGA GACTTCCAGTTTAAGAAAACAGGAGCCATTTATGATGCCATTTTAGCCAGGAAATAA |
Restriction Sites | Please inquire |
ACCN | NM_001171039 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001171039.1, NP_001164510.1 |
RefSeq Size | 1068 bp |
RefSeq ORF | 897 bp |
Locus ID | 438 |
UniProt ID | P46597 |
Protein Families | Druggable Genome |
Protein Pathways | Metabolic pathways, Tryptophan metabolism |
Gene Summary | This gene belongs to the methyltransferase superfamily, and is located in the pseudoautosomal region (PAR) at the end of the short arms of the X and Y chromosomes. The encoded enzyme catalyzes the final reaction in the synthesis of melatonin, and is abundant in the pineal gland. Alternatively spliced transcript variants have been noted for this gene. [provided by RefSeq, Jan 2010] Transcript Variant: This variant (3) is lacking two consecutive in-frame coding exons compared to variant 1. This results in a shorter isoform (2) missing an internal protein segment compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229847 | ASMT (Myc-DDK-tagged)-Human acetylserotonin O-methyltransferase (ASMT), transcript variant 3 |
CNY 3,990.00 |
|
RC229847L3 | Lenti-ORF clone of ASMT (Myc-DDK-tagged)-Human acetylserotonin O-methyltransferase (ASMT), transcript variant 3 |
CNY 5,890.00 |
|
RC229847L4 | Lenti-ORF clone of ASMT (mGFP-tagged)-Human acetylserotonin O-methyltransferase (ASMT), transcript variant 3 |
CNY 5,890.00 |
|
RG229847 | ASMT (tGFP-tagged) - Human acetylserotonin O-methyltransferase (ASMT), transcript variant 3 |
CNY 4,370.00 |