DCI (ECI1) (NM_001178029) Human Untagged Clone

CAT#: SC328467

ECI1 (untagged)-Human dodecenoyl-CoA isomerase (DCI) transcript variant 2



  "NM_001178029" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ECI1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DCI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328467 representing NM_001178029.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGCTGGTGGCTTCTGTGCGAGTCCCGGCGCGCGTTCTGCTCCGCGCGGGGGCCCGGCTCCCGGGC
GCGGCCCTCGGGCGGACGGAGCGGGCGGCCGGCGGCGGAGACGGCGCGCGGCGCTTCGGGAGCCAGCGG
GTGCTGGTGGAGCCGGACGCGGGCGCAGGGGTCGCTGTGATGAAATTCAAGAACCCCCCAGTGAACAGC
CTGAGCCTGGAGTTTCTGACGGAGCTGGTCATCAGCCTGGAGAAGCTGGAGAATGACAAGAGCTTCCGC
GGTGTCATTCTGACCTCGGACCGCCCGGGTGTCTTCTCGGCCGGCCTGGACCTGACGGAGATGTGTGGG
AGGAGCCCCGCCCACTACGCTGGGTACTGGAAGGCCGTTCAGGAGCTGTGGCTGCGGTTGTACCAGTCC
AACCTGGTGCTGGTCTCCGCCATCAACGGAGCCTGCCCCGCTGGAGGCTGCCTGGTGGCCCTGACCTGT
GACTACCGCATCCTGGCGGACAACCCCAGGTTGAAAGACACCCTGGAGAACACCATCGGGCACCGGGCG
GCGGAGCGTGCCCTGCAGCTGGGGCTGCTCTTCCCGCCGGCGGAGGCCCTGCAGGTGGGCATAGTGGAC
CAGGTGGTCCCGGAGGAGCAGGTGCAGAGCACTGCGCTGTCAGCGATAGCCCAGTGGATGGCCATTCCA
GACCATGCTCGACAGCTGACCAAGGCCATGATGCGAAAGGCCACGGCCAGCCGCCTGGTCACGCAGCGC
GATGCGGACGTGCAGAACTTCGTCAGCTTCATCTCCAAAGACTCCATCCAGAAGTCCCTGCAGATGTAC
TTAGAGAGGCTCAAAGAAGAAAAAGGCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001178029
Insert Size 858 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001178029.1
RefSeq Size 1018 bp
RefSeq ORF 858 bp
Locus ID 1632
UniProt ID P42126
Protein Pathways Fatty acid metabolism
MW 30.9 kDa
Gene Summary This gene encodes a member of the hydratase/isomerase superfamily. The protein encoded is a key mitochondrial enzyme involved in beta-oxidation of unsaturated fatty acids. It catalyzes the transformation of 3-cis and 3-trans-enoyl-CoA esters arising during the stepwise degradation of cis-, mono-, and polyunsaturated fatty acids to the 2-trans-enoyl-CoA intermediates. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2010]
Transcript Variant: This variant (2) lacks an in-frame segment in the CDS, as compared to variant 1. The resulting isoform (2) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...