ACT (FHL5) (NM_001170807) Human Untagged Clone

CAT#: SC328466

FHL5 (untagged)-Human four and a half LIM domains 5 (FHL5) transcript variant 2



  "NM_001170807" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-FHL5 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 1700027G07Rik; ACT; dJ393D12.2; FHL-5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328466 representing NM_001170807.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACAACTGCTCACTTTTACTGTCAATACTGCACAGCATCACTTCTTGGGAAGAAATATGTACTAAAG
GATGACAGTCCATACTGTGTTACATGTTATGATCGTGTATTTTCTAACTATTGCGAGGAATGCAAAAAA
CCAATTGAATCTGATTCTAAGGATCTTTGTTACAAAGACCGGCACTGGCATGAAGGATGCTTCAAGTGC
ACCAAATGCAATCACTCTTTGGTGGAAAAGCCTTTTGCTGCCAAGGATGAGCGCCTGCTGTGCACGGAG
TGCTATTCTAACGAGTGCTCCTCCAAGTGCTTCCACTGCAAGAGGACCATCATGCCTGGTTCCCGCAAA
ATGGAATTTAAGGGAAACTACTGGCATGAAACCTGTTTTGTGTGTGAGAATTGCCGACAACCTATAGGG
ACAAAGCCTTTGATCTCCAAAGAGAGTGGCAATTATTGTGTGCCATGTTTTGAGAAGGAGTTTGCTCAC
TACTGCAACTTTTGTAAGAAGGTGATAACTTCAGGTGGGATAACATTTTGTGACCAGCTATGGCATAAA
GAGTGTTTTCTGTGTAGTGGCTGTAGGAAAGATCTCTGTGAAGAACAGTTCATGTCCAGAGACGACTAT
CCATTCTGCGTGGACTGCTACAACCATCTTTATGCCAACAAGTGTGTAGCCTGTTCCAAACCCATTAGT
GGTCTCACAGGTGCCAAGTTTATCTGCTTTCAAGACAGCCAGTGGCATAGCGAATGCTTTAACTGCGGG
AAATGCTCTGTCTCCTTGGTGGGTAAAGGCTTCCTGACCCAGAACAAGGAAATCTTCTGCCAAAAATGT
GGCTCCGGAATGGACACTGACATCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001170807
Insert Size 855 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001170807.2
RefSeq Size 3923 bp
RefSeq ORF 855 bp
Locus ID 9457
UniProt ID Q5TD97
Protein Families Druggable Genome
MW 32.7 kDa
Gene Summary The protein encoded by this gene is coordinately expressed with activator of cAMP-responsive element modulator (CREM). It is associated with CREM and confers a powerful transcriptional activation function. CREM acts as a transcription factor essential for the differentiation of spermatids into mature spermatozoa. There are multiple polyadenylation sites found in this gene. Polymorphisms in this gene may be associated with susceptibility for migraine headaches. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Apr 2016]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1, 2, 3 and 4 all encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...