ACT (FHL5) (NM_001170807) Human Untagged Clone
CAT#: SC328466
FHL5 (untagged)-Human four and a half LIM domains 5 (FHL5) transcript variant 2
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 1700027G07Rik; ACT; dJ393D12.2; FHL-5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC328466 representing NM_001170807.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACAACTGCTCACTTTTACTGTCAATACTGCACAGCATCACTTCTTGGGAAGAAATATGTACTAAAG GATGACAGTCCATACTGTGTTACATGTTATGATCGTGTATTTTCTAACTATTGCGAGGAATGCAAAAAA CCAATTGAATCTGATTCTAAGGATCTTTGTTACAAAGACCGGCACTGGCATGAAGGATGCTTCAAGTGC ACCAAATGCAATCACTCTTTGGTGGAAAAGCCTTTTGCTGCCAAGGATGAGCGCCTGCTGTGCACGGAG TGCTATTCTAACGAGTGCTCCTCCAAGTGCTTCCACTGCAAGAGGACCATCATGCCTGGTTCCCGCAAA ATGGAATTTAAGGGAAACTACTGGCATGAAACCTGTTTTGTGTGTGAGAATTGCCGACAACCTATAGGG ACAAAGCCTTTGATCTCCAAAGAGAGTGGCAATTATTGTGTGCCATGTTTTGAGAAGGAGTTTGCTCAC TACTGCAACTTTTGTAAGAAGGTGATAACTTCAGGTGGGATAACATTTTGTGACCAGCTATGGCATAAA GAGTGTTTTCTGTGTAGTGGCTGTAGGAAAGATCTCTGTGAAGAACAGTTCATGTCCAGAGACGACTAT CCATTCTGCGTGGACTGCTACAACCATCTTTATGCCAACAAGTGTGTAGCCTGTTCCAAACCCATTAGT GGTCTCACAGGTGCCAAGTTTATCTGCTTTCAAGACAGCCAGTGGCATAGCGAATGCTTTAACTGCGGG AAATGCTCTGTCTCCTTGGTGGGTAAAGGCTTCCTGACCCAGAACAAGGAAATCTTCTGCCAAAAATGT GGCTCCGGAATGGACACTGACATCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001170807 |
Insert Size | 855 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001170807.2 |
RefSeq Size | 3923 bp |
RefSeq ORF | 855 bp |
Locus ID | 9457 |
UniProt ID | Q5TD97 |
Protein Families | Druggable Genome |
MW | 32.7 kDa |
Gene Summary | The protein encoded by this gene is coordinately expressed with activator of cAMP-responsive element modulator (CREM). It is associated with CREM and confers a powerful transcriptional activation function. CREM acts as a transcription factor essential for the differentiation of spermatids into mature spermatozoa. There are multiple polyadenylation sites found in this gene. Polymorphisms in this gene may be associated with susceptibility for migraine headaches. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Apr 2016] Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1, 2, 3 and 4 all encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229828 | FHL5 (Myc-DDK-tagged)-Human four and a half LIM domains 5 (FHL5), transcript variant 2 |
CNY 2,400.00 |
|
RC229828L3 | Lenti ORF clone of Human four and a half LIM domains 5 (FHL5), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC229828L4 | Lenti ORF clone of Human four and a half LIM domains 5 (FHL5), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG229828 | FHL5 (tGFP-tagged) - Human four and a half LIM domains 5 (FHL5), transcript variant 2 |
CNY 4,370.00 |