Syntaxin 3 (STX3) (NM_001178040) Human Untagged Clone
CAT#: SC328449
STX3 (untagged)-Human syntaxin 3 (STX3) transcript variant 2
CNY 6,270.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | STX3A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC328449 representing NM_001178040.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGGACCGTCTGGAGCAGCTGAAGGCCAAGCAGCTGACACAGGATGATGATACTGATGCGGTTGAG ATTGCTATCGACAACACGGCTTTTATGGACGAGTTCTTTTCTGAGATTGAGGAAACTCGGCTTAACATT GACAAGATCTCAGAACATGTAGAGGAGGCTAAGAAACTCTACAGTATCATTCTCTCTGCACCGATTCCA GAGCCAAAAACCAAGGATGACCTAGAGCAGCTCACGACTGAGATTAAGAAAAGGGCCAACAACGTCCGG AACAAACTGAAGAGCATGGAGAAGCATATTGAAGAAGATGAGGTCAGGTCATCGGCAGACCTTCGGATT CGGAAATCCCAGCACTCTGTCCTTTCTCGGAAGTTTGTGGAGGTGATGACCAAATACAATGAAGCTCAA GTGGACTTCCGAGAACGCAGCAAAGGGCGAATCCAGCGGCAGCTCGAAATTACTGGCAAAAAGACAACC GATGAGGAGCTGGAGGAGATGTTGGAGAGTGGCAACCCGGCCATCTTCACTTCTGGGATCATTGACTCA CAGATTTCCAAGCAAGCCCTCAGTGAGATTGAGGGACGACACAAGGACATTGTGAGGCTGGAGAGCAGC ATCAAGGAGCTTCACGACATGTTTATGGACATCGCCATGCTGGTGGAGAATCAGGGTGAGATGTTAGAT AACATAGAGTTGAATGTCATGCACACAGTGGACCACGTGGAGAAGGCACGAGATGAAACGAAAAAAGCT GTGAAATACCAGAGTCAGGCCCGGAAGAAACTGATTTCACTCCAGACTGGTGTGGCCACCCTTGTCTTC AGATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001178040 |
Insert Size | 834 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001178040.1 |
RefSeq Size | 6384 bp |
RefSeq ORF | 834 bp |
Locus ID | 6809 |
UniProt ID | Q13277 |
Protein Families | Druggable Genome, Stem cell - Pluripotency, Transmembrane |
Protein Pathways | SNARE interactions in vesicular transport |
MW | 32 kDa |
Gene Summary | The gene is a member of the syntaxin family. The encoded protein is targeted to the apical membrane of epithelial cells where it forms clusters and is important in establishing and maintaining polarity necessary for protein trafficking involving vesicle fusion and exocytosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010] Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift in the 3' coding region, compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229811 | STX3 (Myc-DDK-tagged)-Human syntaxin 3 (STX3), transcript variant 2 |
CNY 2,400.00 |
|
RC229811L3 | Lenti ORF clone of Human syntaxin 3 (STX3), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC229811L4 | Lenti ORF clone of Human syntaxin 3 (STX3), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG229811 | STX3 (tGFP-tagged) - Human syntaxin 3 (STX3), transcript variant 2 |
CNY 4,370.00 |
其它Syntaxin 3产品