Lunatic Fringe (LFNG) (NM_002304) Human Untagged Clone

CAT#: SC328407

LFNG (untagged)-Human LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase (LFNG) transcript variant 4



  "NM_002304" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


LFNG rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SCDO3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_002304, the custom clone sequence may differ by one or more nucleotides
ATGACACCAGGTCGCTGCTGTCTTGCGGCTGACATTCAGGTAGAGACGTTCATCTTCACT
GACGGGGAAGATGAGGCCCTGGCCAGGCACACGGGCAACGTGGTCATCACAAACTGCTCG
GCCGCCCACAGCCGCCAGGCGCTGTCCTGCAAGATGGCCGTGGAGTATGACCGCTTCATC
GAGTCCGGCAGGAAGTGGTTCTGCCACGTGGACGATGACAACTACGTCAACCTGCGGGCC
CTGCTGCGGCTGCTGGCCAGCTACCCGCACACGCGGGACGTCTACGTCGGCAAGCCCAGC
CTGGACAGGCCCATCCAGGCCATGGAGCGGGTCAGCGAGAACAAGGTGCGTCCTGTCCAC
TTCTGGTTTGCCACGGGCGGCGCTGGCTTCTGCATCAGCCGTGGGCTGGCTCTGAAGATG
AGCCCGTGGGCCAGCGGGGGTCACTTCATGAATACGGCTGAGCGGATCCGGCTGCCTGAT
GACTGCACCATCGGCTACATCGTGGAGGCCCTGCTGGGTGTGCCCCTCATCCGCAGCGGC
CTCTTCCACTCCCACCTGGAGAACCTGCAGCAGGTGCCCACCTCGGAGCTCCACGAGCAG
GTGACGCTGAGCTACGGTATGTTTGAAAACAAGCGGAACGCCGTCCACGTGAAGGGGCCC
TTCTCGGTGGAGGCCGACCCATCCAGGTTCCGCTCCATCCACTGCCACCTGTACCCGGAC
ACACCCTGGTGTCCCCGCACTGCCATCTTCTAG
Restriction Sites Please inquire     
ACCN NM_002304
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002304.2, NP_002295.1
RefSeq Size 2068 bp
RefSeq ORF 753 bp
Locus ID 3955
UniProt ID Q8NES3
Protein Families Transmembrane
Protein Pathways Notch signaling pathway
Gene Summary This gene is a member of the glycosyltransferase 31 gene family. Members of this gene family, which also includes the MFNG (GeneID: 4242) and RFNG (GeneID: 5986) genes, encode evolutionarily conserved glycosyltransferases that act in the Notch signaling pathway to define boundaries during embryonic development. While their genomic structure is distinct from other glycosyltransferases, these proteins have a fucose-specific beta-1,3-N-acetylglucosaminyltransferase activity that leads to elongation of O-linked fucose residues on Notch, which alters Notch signaling. The protein encoded by this gene is predicted to be a single-pass type II Golgi membrane protein but it may also be secreted and proteolytically processed like the related proteins in mouse and Drosophila (PMID: 9187150). Mutations in this gene have been associated with autosomal recessive spondylocostal dysostosis 3. [provided by RefSeq, May 2018]
Transcript Variant: This variant (4) has multiple differences, compared to variant 1. These differences result in a distinct 5' UTR and cause translation initiation at an alternate start codon, compared to variant 1. The encoded protein (isoform d) has a shorter and distinct N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...