United States
Germany
Japan
United Kingdom
China
BAG1 (NM_001172415) Human Untagged Clone
CAT＃: SC328365
BAG1 (untagged)-Human BCL2-associated athanogene (BAG1) transcript variant 1
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BAG-1; HAP; RAP46 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001172415, the custom clone sequence may differ by one or more nucleotides
ATGAATCGGAGCCAGGAGGTGACCCGGGACGAGGAGTCGACCCGGAGCGAGGAGGTGACC AGGGAGGAAATGGCGGCAGCTGGGCTCACCGTGACTGTCACCCACAGCAATGAGAAGCAC GACCTTCATGTTACCTCCCAGCAGGGCAGCAGTGAACCAGTTGTCCAAGACCTGGCCCAG GTTGTTGAAGAGGTCATAGGGGTTCCACAGTCTTTTCAGAAACTCATATTTAAGGGAAAA TCTCTGAAGGAAATGGAAACACCGTTGTCAGCACTTGGAATACAAGATGGTTGCCGGGTC ATGTTAATTGGGAAAAAGAACAGTCCACAGGAAGAGGTTGAACTAAAGAAGTTGAAACAT TTGGAGAAGTCTGTGGAGAAGATAGCTGACCAGCTGGAAGAGTTGAATAAAGAGCTTACT GGAATCCAGCAGGGTTTTCTGCCCAAGGATTTGCAAGCTGAAGCTCTCTGCAAACTTGAT AGGAGAGTAAAAGCCACAATAGAGCAGTTTATGAAGATCTTGGAGGAGATTGACACACTG ATCCTGCCAGAAAATTTCAAAGACAGTAGATTGAAAAGGAAAGGCTTGGTAAAAAAGGTT CAGGCATTCCTAGCCGAGTGTGACACAGTGGAGCAGAACATCTGCCAGGAGACTGAGCGG CTGCAGTCTACAAACTTTGCCCTGGCCGAGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001172415 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001172415.1, NP_001165886.1 |
| RefSeq Size | 3885 bp |
| RefSeq ORF | 693 bp |
| Locus ID | 573 |
| UniProt ID | Q99933 |
| Protein Families | Druggable Genome |
| Gene Summary | The oncogene BCL2 is a membrane protein that blocks a step in a pathway leading to apoptosis or programmed cell death. The protein encoded by this gene binds to BCL2 and is referred to as BCL2-associated athanogene. It enhances the anti-apoptotic effects of BCL2 and represents a link between growth factor receptors and anti-apoptotic mechanisms. Multiple protein isoforms are encoded by this mRNA through the use of a non-AUG (CUG) initiation codon, and three alternative downstream AUG initiation codons. A related pseudogene has been defined on chromosome X. [provided by RefSeq, Feb 2010] Transcript Variant: This transcript (1) encodes multiple isoforms due to the use of alternative translation initiation codons. The longest isoform (BAG-1L or p50) is derived from an upstream non-AUG (CUG) start codon, while three shorter isoforms are derived from downstream AUG start codons. The most abundant of the shorter isoforms (BAG-1S, also known as p33 or p36), which is derived from the second downstream AUG start codon, is represented in this RefSeq. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: This CCDS ID represents the most abundant of the shorter human BAG1 isoforms, known as BAG-1S or p36 or p33, as described in the literature, including PMIDs 9396724, 9679980, 9747877 and 17662274. This isoform initiates translation at a downstream AUG start codon. Alternative translation initiation at other AUG start codons produces additional isoforms, known as BAG-1M or p46, and p29. In addition, alternative translation initiation from an upstream non-AUG (CUG) start codon results in the longest human BAG1 isoform, known as BAG-1L or p50. The longest isoform is represented by CCDS 35004.1. Evidence in PMIDs 9747877 and 17662274 indicates that these isoforms have distinct subcellular distributions, which may contribute to the multifunctionality of the protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229727 | BAG1 (Myc-DDK-tagged)-Human BCL2-associated athanogene (BAG1), transcript variant 1 |
CNY 3,990.00 |
|
| RC229727L3 | Lenti-ORF clone of BAG1 (Myc-DDK-tagged)-Human BCL2-associated athanogene (BAG1), transcript variant 1 |
CNY 5,890.00 |
|
| RC229727L4 | Lenti-ORF clone of BAG1 (mGFP-tagged)-Human BCL2-associated athanogene (BAG1), transcript variant 1 |
CNY 5,890.00 |
|
| RG229727 | BAG1 (tGFP-tagged) - Human BCL2-associated athanogene (BAG1), transcript variant 1 |
CNY 4,370.00 |
