TESC (NM_001168325) Human Untagged Clone
CAT#: SC328290
TESC (untagged)-Human tescalcin (TESC) transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CHP3; TSC |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC328290 representing NM_001168325.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGCGCTGCCCACTCCGCGTCTGAGGAGGTGCGGGAGCTCGAGGGCAAGACCGGCTTCTCATCGGAT CAGATCGAGCAGCTCCATCGGAGATTTAAGCAGCTGAGTGGAGATCAGCCTACCATTCGGAACCTGCGC AAGGGACCCAGTGGCCTGGCTGATGAGATCAATTTCGAGGACTTCCTGACCATCATGTCCTACTTCCGG CCCATCGACACCACCATGGACGAGGAACAGGTGGAGCTGTCCCGGAAGGAGAAGCTGAGATTTCTGTTC CACATGTACGACTCGGACAGCGACGGCCGCATCACTCTGGAAGAATATCGAAATGTGGTCGAGGAGCTG CTGTCGGGAAACCCTCACATCGAGAAGGAGTCCGCTCGCTCCATCGCCGACGGGGCCATGATGGAGGCG GCCAGCGTGTGCATGGGGCAGATGGAGCCTGATCAGGTGTACGAGGGGATCACCTTCGAGGACTTCCTG AAGATCTGGCAGGGGATCGACATTGAGACCAAGATGCACGTCCGCTTCCTTAACATGGAAACCATGGCC CTCTGCCACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001168325 |
Insert Size | 564 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001168325.1 |
RefSeq Size | 958 bp |
RefSeq ORF | 564 bp |
Locus ID | 54997 |
UniProt ID | Q96BS2 |
MW | 21.5 kDa |
Gene Summary | Functions as an integral cofactor in cell pH regulation by controlling plasma membrane-type Na(+)/H(+) exchange activity. Promotes the maturation, transport, cell surface stability and exchange activity of SLC9A1/NHE1 at the plasma membrane. Promotes the induction of hematopoietic stem cell differentiation toward megakaryocytic lineage. Essential for the coupling of ERK cascade activation with the expression of ETS family genes in megakaryocytic differentiation. Also involved in granulocytic differentiation in a ERK-dependent manner. Inhibits the phosphatase activity of calcineurin.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229652 | TESC (Myc-DDK-tagged)-Human tescalcin (TESC), transcript variant 2 |
CNY 2,400.00 |
|
RC229652L3 | Lenti ORF clone of Human tescalcin (TESC), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC229652L4 | Lenti ORF clone of Human tescalcin (TESC), transcript variant 2, mGFP tagged |
CNY 4,800.00 |
|
RG229652 | TESC (tGFP-tagged) - Human tescalcin (TESC), transcript variant 2 |
CNY 4,370.00 |