United States
Germany
Japan
United Kingdom
China
RNF166 (NM_001171816) Human Untagged Clone
CAT＃: SC328199
RNF166 (untagged)-Human ring finger protein 166 (RNF166) transcript variant 3
CN¥ 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001171816, the custom clone sequence may differ by one or more nucleotides
ATGAGAGTGCACATTTCGTCCTGCCTGAAGGTCCAGGAGCAGATGGCCAACTGCCCCAAG TTCGTCCCCGTGGTGCCCACATCACAGCCTATCCCCAGCAACATCCCCAACAGGTCCACC TTCGCCTGCCCGTACTGTGGTGCCCGCAACCTGGACCAGCAGGAGCTGGTGAAGCACTGT GTGGAAAGCCACCGCAGCGACCCCAACCGCGTGGTGTGCCCCATCTGCTCGGCAATGCCC TGGGGGGACCCCAGCTACAAGAGCGCCAACTTCCTGCAGCACCTGCTTCACCGACACAAG TTCTCCTACGACACCTTTGTGGACTACAGTATTGACGAGGAGGCCGCCTTCCAGGCTGCT CTGGCCCTGTCTCTCTCTGAGAACTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001171816 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001171816.1, NP_001165287.1 |
| RefSeq Size | 2465 bp |
| RefSeq ORF | 387 bp |
| Locus ID | 115992 |
| UniProt ID | Q96A37 |
| Protein Families | Druggable Genome |
| Gene Summary | E3 ubiquitin-protein ligase that promotes the ubiquitination of different substrates (PubMed:27880896). In turn, participates in different biological processes including interferon production or autophagy (PubMed:26456228, PubMed:27880896). Plays a role in the activation of RNA virus-induced interferon-beta production by promoting the ubiquitination of TRAF3 and TRAF6 (PubMed:26456228). Plays also a role in the early recruitment of autophagy adapters to bacteria (PubMed:27880896). Mediates 'Lys-29' and 'Lys-33'-linked ubiquitination of SQSTM1 leading to xenophagic targeting of bacteria and inhibition of their replication (PubMed:27880896).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream start codon, compared to variant 1. The resulting isoform (3) is shorter at the N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229561 | RNF166 (Myc-DDK-tagged)-Human ring finger protein 166 (RNF166), transcript variant 3 |
CN¥ 3,990.00 |
|
| RC229561L3 | Lenti-ORF clone of RNF166 (Myc-DDK-tagged)-Human ring finger protein 166 (RNF166), transcript variant 3 |
CN¥ 5,890.00 |
|
| RC229561L4 | Lenti-ORF clone of RNF166 (mGFP-tagged)-Human ring finger protein 166 (RNF166), transcript variant 3 |
CN¥ 5,890.00 |
|
| RG229561 | RNF166 (tGFP-tagged) - Human ring finger protein 166 (RNF166), transcript variant 3 |
CN¥ 4,370.00 |
