United States
Germany
Japan
United Kingdom
China
NDUFS5 (NM_001184979) Human Untagged Clone
CAT＃: SC328174
NDUFS5 (untagged)-Human NADH dehydrogenase (ubiquinone) Fe-S protein 5 15kDa (NADH-coenzyme Q reductase) (NDUFS5) nuclear gene encoding mitochondrial protein transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CI-15k; CI15K |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001184979, the custom clone sequence may differ by one or more nucleotides
ATGCCTTTCTTGGACATCCAGAAAAGGTTCGGCCTTAACATAGATCGATGGTTGACAATC CAGAGTGGTGAACAGCCCTACAAGATGGCTGGTCGATGCCATGCTTTTGAAAAAGAATGG ATAGAATGTGCACATGGAATCGGTTATACTCGGGCAGAGAAAGAGTGCAAGATAGAATAT GATGATTTCGTAGAGTGTTTGCTTCGGCAGAAAACGATGAGACGTGCAGGTACCATCAGG AAGCAGCGGGATAAGCTGATAAAGGAAGGAAAGTACACCCCTCCACCTCACCACATTGGC AAGGGGGAGCCTCGGCCCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001184979 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001184979.1, NP_001171908.1 |
| RefSeq Size | 580 bp |
| RefSeq ORF | 321 bp |
| Locus ID | 4725 |
| UniProt ID | O43920 |
| Protein Pathways | Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
| Gene Summary | This gene is a member of the NADH dehydrogenase (ubiquinone) iron-sulfur protein family. The encoded protein is a subunit of the NADH:ubiquinone oxidoreductase (complex I), the first enzyme complex in the electron transport chain located in the inner mitochondrial membrane. Alternative splicing results in multiple transcript variants and pseudogenes have been identified on chromosomes 1, 4 and 17. [provided by RefSeq, May 2010] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229536 | NDUFS5 (Myc-DDK-tagged)-Human NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase) (NDUFS5), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 1,200.00 |
|
| RC229536L3 | Lenti-ORF clone of NDUFS5 (Myc-DDK-tagged)-Human NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase) (NDUFS5), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5,890.00 |
|
| RC229536L4 | Lenti-ORF clone of NDUFS5 (mGFP-tagged)-Human NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase) (NDUFS5), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5,890.00 |
|
| RG229536 | NDUFS5 (tGFP-tagged) - Human NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase) (NDUFS5), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 4,370.00 |
