United States
Germany
Japan
United Kingdom
China
Neurokinin B (TAC3) (NM_001178054) Human Untagged Clone
CAT＃: SC328169
TAC3 (untagged)-Human tachykinin 3 (TAC3) transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HH10; LncZBTB39; NK3; NKB; NKNB; PRO1155; ZNEUROK1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001178054, the custom clone sequence may differ by one or more nucleotides
ATGAGGATCATGCTGCTATTCACAGCCATCCTGGCCTTCAGCCTAGCTCAGAGCTTTGGG GCTGTCTGTAAGGAGCCACAGGAGGAGGTGGTTCCTGGCGGGGGCCGCAGCAAGAGGGAT CCAGATCTCTACCAGCTGCTCCAGAGACTCTTCAAAAGCCACTCATCTCTGGAGGGATTG CTCAAAGCCCTGAGCCAGGCTAGCACAGATCCTAAGGAATCAACATCTCCCGAGAAACAC TCTCCTACGGATGTGAATCAAGAGAACGTCCCCAGCTTTGGCATCCTCAAGTATCCCCCG AGAGCAGAATAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001178054 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001178054.1, NP_001171525.1 |
| RefSeq Size | 787 bp |
| RefSeq ORF | 312 bp |
| Locus ID | 6866 |
| UniProt ID | Q9UHF0 |
| Protein Families | Druggable Genome, Secreted Protein |
| Gene Summary | This gene encodes a member of the tachykinin family of secreted neuropeptides. The encoded preproprotein is proteolytically processed to generate the mature peptide, which is primarily expressed in the central and peripheral nervous systems and functions as a neurotransmitter. This peptide is the ligand for the neurokinin-3 receptor. This protein is also expressed in the outer syncytiotrophoblast of the placenta and may be associated with pregnancy-induced hypertension and pre-eclampsia. Mutations in this gene are associated with normosmic hypogonadotropic hypogonadism. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (2) lacks an in-frame exon in the coding region, compared to variant 1. The encoded isoform (2) is shorter and lacks the entire Neurokinin-B peptide compared to isoform 1. The encoded isoform (2) and may undergo proteolytic processing similar to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229531 | TAC3 (Myc-DDK-tagged)-Human tachykinin 3 (TAC3), transcript variant 2 |
CNY 3,990.00 |
|
| RC229531L3 | Lenti-ORF clone of TAC3 (Myc-DDK-tagged)-Human tachykinin 3 (TAC3), transcript variant 2 |
CNY 5,890.00 |
|
| RC229531L4 | Lenti-ORF clone of TAC3 (mGFP-tagged)-Human tachykinin 3 (TAC3), transcript variant 2 |
CNY 5,890.00 |
|
| RG229531 | TAC3 (tGFP-tagged) - Human tachykinin 3 (TAC3), transcript variant 2 |
CNY 4,370.00 |
其它Neurokinin B产品
