MYD88 (NM_002468) Human Untagged Clone
CAT#: SC327786
MYD88 (untagged)-Human myeloid differentiation primary response gene (88) (MYD88)
CNY 6,270.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | IMD68; MYD88D |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC327786 representing NM_002468.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCGACCCGACCGCGCTGAGGCTCCAGGACCGCCCGCCATGGCTGCAGGAGGTCCCGGCGCGGGGTCT GCGGCCCCGGTCTCCTCCACATCCTCCCTTCCCCTGGCTGCTCTCAACATGCGAGTGCGGCGCCGCCTG TCTCTGTTCTTGAACGTGCGGACACAGGTGGCGGCCGACTGGACCGCGCTGGCGGAGGAGATGGACTTT GAGTACTTGGAGATCCGGCAACTGGAGACACAAGCGGACCCCACTGGCAGGCTGCTGGACGCCTGGCAG GGACGCCCTGGCGCCTCTGTAGGCCGACTGCTCGAGCTGCTTACCAAGCTGGGCCGCGACGACGTGCTG CTGGAGCTGGGACCCAGCATTGAGGAGGATTGCCAAAAGTATATCTTGAAGCAGCAGCAGGAGGAGGCT GAGAAGCCTTTACAGGTGGCCGCTGTAGACAGCAGTGTCCCACGGACAGCAGAGCTGGCGGGCATCACC ACACTTGATGACCCCCTGGGGCATATGCCTGAGCGTTTCGATGCCTTCATCTGCTATTGCCCCAGCGAC ATCCAGTTTGTGCAGGAGATGATCCGGCAACTGGAACAGACAAACTATCGACTGAAGTTGTGTGTGTCT GACCGCGATGTCCTGCCTGGCACCTGTGTCTGGTCTATTGCTAGTGAGCTCATCGAAAAGAGGTGCCGC CGGATGGTGGTGGTTGTCTCTGATGATTACCTGCAGAGCAAGGAATGTGACTTCCAGACCAAATTTGCA CTCAGCCTCTCTCCAGGTGCCCATCAGAAGCGACTGATCCCCATCAAGTACAAGGCAATGAAGAAAGAG TTCCCCAGCATCCTGAGGTTCATCACTGTCTGCGACTACACCAACCCCTGCACCAAATCTTGGTTCTGG ACTCGCCTTGCCAAGGCCTTGTCCCTGCCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_002468 |
Insert Size | 930 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002468.4 |
RefSeq Size | 2862 bp |
RefSeq ORF | 930 bp |
Locus ID | 4615 |
UniProt ID | Q99836 |
Domains | TIR, DEATH |
Protein Families | Druggable Genome |
Protein Pathways | Apoptosis, Toll-like receptor signaling pathway |
MW | 34.6 kDa |
Gene Summary | This gene encodes a cytosolic adapter protein that plays a central role in the innate and adaptive immune response. This protein functions as an essential signal transducer in the interleukin-1 and Toll-like receptor signaling pathways. These pathways regulate that activation of numerous proinflammatory genes. The encoded protein consists of an N-terminal death domain and a C-terminal Toll-interleukin1 receptor domain. Patients with defects in this gene have an increased susceptibility to pyogenic bacterial infections. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
WW Domain Containing E3 Ubiquitin Protein Ligase 1 (WWP1) Negatively Regulates TLR4-Mediated TNF-? and IL-6 Production by Proteasomal Degradation of TNF Receptor Associated Factor 6 (TRAF6)
,null,
PLoS ONE
,PubMed ID 23799152
[MYD88]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202253 | MYD88 (Myc-DDK-tagged)-Human myeloid differentiation primary response gene (88) (MYD88), transcript variant 2 |
CNY 3,600.00 |
|
RC202253L1 | Lenti ORF clone of Human myeloid differentiation primary response gene (88) (MYD88), transcript variant 2, Myc-DDK-tagged |
CNY 6,000.00 |
|
RC202253L2 | Lenti ORF clone of Human myeloid differentiation primary response gene (88) (MYD88), transcript variant 2, mGFP tagged |
CNY 6,000.00 |
|
RC202253L3 | Lenti ORF clone of Human myeloid differentiation primary response gene (88) (MYD88), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC202253L4 | Lenti ORF clone of Human myeloid differentiation primary response gene (88) (MYD88), transcript variant 2, mGFP tagged |
CNY 6,000.00 |
|
RC229151 | MYD88 (Myc-DDK-tagged)-Human myeloid differentiation primary response gene (88) (MYD88), transcript variant 2 |
CNY 3,600.00 |
|
RG202253 | MYD88 (tGFP-tagged) - Human myeloid differentiation primary response gene (88) (MYD88), transcript variant 2 |
CNY 5,200.00 |
|
RG229151 | MYD88 (tGFP-tagged) - Human myeloid differentiation primary response gene (88) (MYD88), transcript variant 2 |
CNY 5,200.00 |
|
SC118606 | MYD88 (untagged)-Human myeloid differentiation primary response gene (88) (MYD88), transcript variant 2 |
CNY 3,600.00 |