SAP18 (NM_005870) Human Untagged Clone
CAT#: SC327746
SAP18 (untagged)-Human Sin3A-associated protein 18kDa (SAP18)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 2HOR0202; SAP18P |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC327746 representing NM_005870.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTCGCTGCAGGGGTCGGAGGTCAGGGCGAGCGTCTCGCAGGCCGTAGGAGGAAGATGGCGGTGGAG TCGCGCGTTACCCAGGAGGAAATTAAGAAGGAGCCAGAGAAACCGATCGACCGCGAGAAGACATGCCCA CTGTTGCTACGGGTCTTCACCACCAATAACGGCCGCCACCACCGAATGGACGAGTTCTCCCGGGGAAAT GTACCGTCCAGCGAGTTGCAGATCTACACTTGGATGGATGCAACCTTGAAAGAACTGACAAGCTTAGTA AAAGAAGTCTACCCAGAAGCTAGAAAGAAGGGCACTCACTTCAATTTTGCAATCGTTTTTACAGATGTT AAAAGACCTGGCTATCGAGTTAAGGAGATTGGCAGCACCATGTCTGGCAGAAAGGGGACTGATGATTCC ATGACCCTGCAGTCGCAGAAGTTCCAGATAGGAGATTACTTGGACATAGCAATTACCCCTCCAAATCGG GCACCACCTCCTTCAGGGCGCATGAGACCATATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_005870 |
Insert Size | 519 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_005870.4 |
RefSeq Size | 2318 bp |
RefSeq ORF | 519 bp |
Locus ID | 10284 |
UniProt ID | O00422 |
Protein Families | Druggable Genome, Transcription Factors |
MW | 19.5 kDa |
Gene Summary | Histone acetylation plays a key role in the regulation of eukaryotic gene expression. Histone acetylation and deacetylation are catalyzed by multisubunit complexes. The protein encoded by this gene is a component of the histone deacetylase complex, which includes SIN3, SAP30, HDAC1, HDAC2, RbAp46, RbAp48, and other polypeptides. This protein directly interacts with SIN3 and enhances SIN3-mediated transcriptional repression when tethered to the promoter. A pseudogene has been identified on chromosome 2. [provided by RefSeq, Dec 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205607 | SAP18 (Myc-DDK-tagged)-Human Sin3A-associated protein, 18kDa (SAP18) |
CNY 1,200.00 |
|
RC205607L1 | Lenti ORF clone of Human Sin3A-associated protein, 18kDa (SAP18), Myc-DDK-tagged |
CNY 3,600.00 |
|
RC205607L2 | Lenti ORF clone of Human Sin3A-associated protein, 18kDa (SAP18), mGFP tagged |
CNY 5,890.00 |
|
RC205607L3 | Lenti ORF clone of Human Sin3A-associated protein, 18kDa (SAP18), Myc-DDK-tagged |
CNY 3,600.00 |
|
RC205607L4 | Lenti ORF clone of Human Sin3A-associated protein, 18kDa (SAP18), mGFP tagged |
CNY 3,600.00 |
|
RG205607 | SAP18 (tGFP-tagged) - Human Sin3A-associated protein, 18kDa (SAP18) |
CNY 2,800.00 |
|
SC111144 | SAP18 (untagged)-Human Sin3A-associated protein, 18kDa (SAP18) |
CNY 1,200.00 |