TCF7L2 (NM_001146284) Human Untagged Clone
CAT#: SC327541
TCF7L2 (untagged)-Human transcription factor 7-like 2 (T-cell specific HMG-box) (TCF7L2) transcript variant 4
CNY 7,220.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | TCF-4; TCF4 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001146284, the custom clone sequence may differ by one or more nucleotides
ATGCCGCAGCTGAACGGCGGTGGAGGGGATGACCTAGGCGCCAACGACGAACTGATTTCC TTCAAAGACGAGGGCGAACAGGAGGAGAAGAGCTCCGAAAACTCCTCGGCAGAGAGGGAT TTAGCTGATGTCAAATCGTCTCTAGTCAATGAATCAGAAACGAATCAAAACAGCTCCTCC GATTCCGAGGCGGAAAGACGGCCTCCGCCTCGCTCCGAAAGTTTCCGAGACAAATCCCGG GAAAGTTTGGAAGAAGCGGCCAAGAGGCAAGATGGAGGGCTCTTTAAGGGGCCACCGTAT CCCGGCTACCCCTTCATCATGATCCCCGACCTGACGAGCCCCTACCTCCCCAACGGATCG CTCTCGCCCACCGCCCGAACCTATCTCCAGATGAAATGGCCACTGCTTGATGTCCAGGCA GGGAGCCTCCAGAGTAGACAAGCCCTCAAGGATGCCCGGTCCCCATCACCGGCACACATT GTCTCTAACAAAGTGCCAGTGGTGCAGCACCCTCACCATGTCCACCCCCTCACGCCTCTT ATCACGTACAGCAATGAACACTTCACGCCGGGAAACCCACCTCCACACTTACCAGCCGAC GTAGACCCCAAAACAGGAATCCCACGGCCTCCGCACCCTCCAGATATATCCCCGTATTAC CCACTATCGCCTGGCACCGTAGGACAAATCCCCCATCCGCTAGGATGGCAAGGTCAACCA GTGTACCCAATCACGACAGGAGGATTCAGACACCCCTACCCCACAGCTCTGACCGTCAAT GCTTCCATGTCCAGGTTCCCTCCCCATATGGTCCCACCACATCATACGCTACACACGACG GGCATTCCGCATCCGGCCATAGTCACACCAACAGTCAAACAGGAATCGTCCCAGAGTGAT GTCGGCTCACTCCATAGTTCAAAGCATCAGGACTCCAAAAAGGAAGAAGAAAAGAAGAAG CCCCACATAAAGAAACCTCTTAATGCATTCATGTTGTATATGAAGGAAATGAGAGCAAAG GTCGTAGCTGAGTGCACGTTGAAAGAAAGCGCGGCCATCAACCAGATCCTTGGGCGGAGG TGGCATGCACTGTCCAGAGAAGAGCAAGCGAAATACTACGAGCTGGCCCGGAAGGAGCGA CAGCTTCATATGCAACTGTACCCCGGCTGGTCCGCGCGGGATAACTATGGAAAGAAGAAG AAGAGGAAAAGGGACAAGCAGCCGGGAGAGACCAATGAACACAGCGAATGTTTCCTAAAT CCTTGCCTTTCACTTCCTCCGATTACAGGAGAAAAAAAAAGTGCGTTCGCTACATACAAG GTGAAGGCAGCTGCCTCAGCCCACCCTCTTCAGATGGAAGCTTAC |
Restriction Sites | Please inquire |
ACCN | NM_001146284 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001146284.1, NP_001139756.1 |
RefSeq Size | 3919 bp |
RefSeq ORF | 1368 bp |
Locus ID | 6934 |
UniProt ID | Q9NQB0 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Acute myeloid leukemia, Adherens junction, Arrhythmogenic right ventricular cardiomyopathy (ARVC), Basal cell carcinoma, Colorectal cancer, Endometrial cancer, Melanogenesis, Pathways in cancer, Prostate cancer, Thyroid cancer, Wnt signaling pathway |
Gene Summary | This gene encodes a high mobility group (HMG) box-containing transcription factor that plays a key role in the Wnt signaling pathway. The protein has been implicated in blood glucose homeostasis. Genetic variants of this gene are associated with increased risk of type 2 diabetes. Several transcript variants encoding multiple different isoforms have been found for this gene.[provided by RefSeq, Oct 2010] Transcript Variant: This variant (4) has multiple differences in the coding region, compared to variant 1, one of which results in a translational frameshift. The resulting protein (isoform 4) has a distinct C-terminus and is shorter than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228906 | TCF7L2 (Myc-DDK-tagged)-Human transcription factor 7-like 2 (T-cell specific, HMG-box) (TCF7L2), transcript variant 4 |
CNY 3,990.00 |
|
RC228906L3 | Lenti-ORF clone of TCF7L2 (Myc-DDK-tagged)-Human transcription factor 7-like 2 (T-cell specific, HMG-box) (TCF7L2), transcript variant 4 |
CNY 5,890.00 |
|
RC228906L4 | Lenti-ORF clone of TCF7L2 (mGFP-tagged)-Human transcription factor 7-like 2 (T-cell specific, HMG-box) (TCF7L2), transcript variant 4 |
CNY 5,890.00 |
|
RG228906 | TCF7L2 (tGFP-tagged) - Human transcription factor 7-like 2 (T-cell specific, HMG-box) (TCF7L2), transcript variant 4 |
CNY 4,370.00 |