NDUFV1 (NM_001166102) Human Untagged Clone
CAT#: SC327539
NDUFV1 (untagged)-Human NADH dehydrogenase (ubiquinone) flavoprotein 1 51kDa (NDUFV1) nuclear gene encoding mitochondrial protein transcript variant 2
CNY 7,220.00
Product images
CNY 6,281.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CI-51K; CI51KD; MC1DN4; UQOR1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001166102, the custom clone sequence may differ by one or more nucleotides
ATGCTGGCAACACGGCGGCTGCTCGGCTGGTCGCTTCCCGCGCGGACAGCACCCAAGAAA ACCTCATTTGGCTCGCTGAAGGATGAAGACCGGATTTTCACCAACCTGTACGGCCGCCAT GACTGGAGGCTGAAAGGTTCCCTGAGTCGAGGTGACTGGTACAAGACAAAGGAGATCCTG CTGAAGGGGCCCGACTGGATCCTGGGCGAGATCAAGACATCGGGTTTGAGGGGCCGTGGA GGCGCTGGCTTCCCCACTGGCCTCAAGTGGAGCTTCATGAATAAGCCCTCAGATGGCAGG CCCAAGTATCTGGTGGTGAACGCAGACGAGGGGGAGCCGGGCACCTGCAAGGACCGGGAG ATCTTACGCCATGATCCTCACAAGCTGCTGGAAGGCTGCCTGGTGGGGGGCCGGGCCATG GGCGCCCGCGCTGCCTATATCTACATCCGAGGGGAATTCTACAATGAGGCCTCCAATCTG CAGGTGGCCATCCGAGAGGCCTATGAGGCAGGTCTGATTGGCAAGAATGCTTGTGGCTCT GGCTATGATTTTGACGTGTTTGTGGTGCGCGGGGCTGGGGCCTACATCTGTGGAGAGGAG ACAGCGCTCATCGAGTCCATTGAGGGCAAGCAGGGCAAGCCCCGCCTGAAGCCCCCCTTC CCCGCAGACGTGGGAGTGTTTGGCTGCCCCACAACTGTGGCCAACGTGGAGACAGTGGCA GTGTCCCCCACAATCTGCCGCCGTGGAGGTACCTGGTTTGCTGGCTTTGGCAGAGAACGC AACTCAGGCACCAAACTATTCAACATCTCTGGCCATGTCAACCACCCTTGCACTGTGGAG GAGGAGATGTCTGTGCCCTTGAAAGAACTGATTGAGAAGCATGCTGGGGGTGTCACGGGC GGCTGGGACAACCTCCTTGCTGTGATCCCTGGCGGCTCGTCTACCCCACTGATCCCCAAG TCTGTGTGTGAGACGGTGCTGATGGACTTCGATGCGCTGGTGCAGGCACAGACAGGCCTG GGCACAGCTGCGGTGATCGTCATGGACCGCTCGACGGACATCGTGAAAGCCATCGCCCGC CTCATTGAGTTCTATAAGCACGAGAGCTGTGGCCAGTGTACCCCATGCCGTGAGGGTGTG GACTGGATGAACAAGGTGATGGCACGTTTCGTGAGGGGGGATGCCCGGCCGGCCGAGATC GACTCCCTGTGGGAGATCAGCAAGCAGATAGAAGGCCATACGATTTGTGCTCTGGGTGAC GGGGCCGCCTGGCCTGTGCAGGGTCTGATCCGCCACTTTCGGCCGGAGCTCGAGGAGCGG ATGCAGCGGTTTGCCCAGCAGCATCAGGCCCGGCAGGCTGCCTCT |
Restriction Sites | Please inquire |
ACCN | NM_001166102 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001166102.1, NP_001159574.1 |
RefSeq Size | 1604 bp |
RefSeq ORF | 1368 bp |
Locus ID | 4723 |
UniProt ID | P49821 |
Protein Families | Druggable Genome |
Protein Pathways | Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
Gene Summary | The mitochondrial respiratory chain provides energy to cells via oxidative phosphorylation and consists of four membrane-bound electron-transporting protein complexes (I-IV) and an ATP synthase (complex V). This gene encodes a 51 kDa subunit of the NADH:ubiquinone oxidoreductase complex I; a large complex with at least 45 nuclear and mitochondrial encoded subunits that liberates electrons from NADH and channels them to ubiquinone. This subunit carries the NADH-binding site as well as flavin mononucleotide (FMN)- and Fe-S-biding sites. Defects in complex I are a common cause of mitochondrial dysfunction; a syndrome that occurs in approximately 1 in 10,000 live births. Mitochondrial complex I deficiency is linked to myopathies, encephalomyopathies, and neurodegenerative disorders such as Parkinson's disease and Leigh syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1, resulting in a shorter protein (isoform 2), compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228904 | NDUFV1 (Myc-DDK-tagged)-Human NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa (NDUFV1), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 4,560.00 |
|
RC228904L3 | Lenti-ORF clone of NDUFV1 (Myc-DDK-tagged)-Human NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa (NDUFV1), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 6,460.00 |
|
RC228904L4 | Lenti-ORF clone of NDUFV1 (mGFP-tagged)-Human NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa (NDUFV1), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 6,460.00 |
|
RG228904 | NDUFV1 (tGFP-tagged) - Human NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa (NDUFV1), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5,040.00 |