Perilipin 3 (PLIN3) (NM_001164189) Human Untagged Clone

CAT#: SC327531

PLIN3 (untagged)-Human perilipin 3 (PLIN3) transcript variant 2



  "NM_001164189" in other vectors (4)

CNY 7,220.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PLIN3 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms M6PRBP1; PP17; TIP47
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001164189, the custom clone sequence may differ by one or more nucleotides
ATGTCTGCCGACGGGGCAGAGGCTGATGGCAGCACCCAGGTGACAGTGGAAGAACCGGTA
CAGCAGCCCAGTGTGGTGGACCGTGTGGCCAGCATGCCTCTGATCAGCTCCACCTGCGAC
ATGGTGTCCGCAGCCTATGCCTCCACCAAGGAGAGCTACCCGCACATCAAGACTGTCTGC
GACGCAGCAGAGAAGGGAGTGAGGACCCTCACGGCGGCTGCTGTCAGCGGGGCTCAGCCG
ATCCTCTCCAAGCTGGAGCCCCAGATTGCATCAGCCAGCGAATACGCCCACAGGGGGCTG
GACAAGTTGGAGGAGAACCTCCCCATCCTGCAGCAGCCCACGGAGAAGGTCCTGGCGGAC
ACCAAGGAGCTTGTGTCGTCTAAGGTGTCGGGGGCCCAAGAGATGGTGTCTAGCGCCAAG
GACACGGTGGCCACCCAATTGTCGGAGGCGGTGGACGCGACCCGCGGTGCTGTGCAGAGC
GGCGTGGACAAGACAAAGTCCGTAGTGACCGGCGGCGTCCAATCGGTCATGGGCTCCCGC
TTGGGCCAGATGGTGTTGAGTGGGGTCGACACGGTGCTGGGGAAGTCGGAGGAGTGGGCG
GACAACCACCTGCCCCTTACGGATGCCGAACTGGCCCGCATCGCCACATCCCTGGATGGC
TTTGACGTCGCGTCCGTGCAGCAGCAGCGGCAGGAACAGAGCTACTTCGTACGTCTGGGC
TCCCTGTCGGAGAGGCTGCGGCAGCACGCCTATGAGCACTCGCTGGGCAAGCTTCGAGCC
ACCAAGCAGAGGGCACAGGAGGCTCTGCTGCAGCTGTCGCAGGTCCTAAGCCTGATGGAA
ACTGTCAAGCAAGGCGTTGATCAGAAGCTGGTGGAAGGCCAGGAGAAGCTGCACCAGATG
TGGCTCAGCTGGAACCAGAAGCAGCTCCAGGGCCCCGAGAAGGAGCCGCCCAAGCCAGAG
GTCGAGTCCCGGGCGCTCACCATGTTCCGGGACATTGCCCAGCAACTGCAGGCCACCTGT
ACCTCCCTGGGGTCCAGCATTCAGGGCCTCCCCACCAATGTGAAGGACCAGGTGCAGCAG
GCCCGCCGCCAGGTGGAGGACCTCCAGGCCACGTTTTCCAGCATCCACTCCTTCCAGGAC
CTGTCCAGCAGCATTCTGGCCCAGAGCCGTGAGCGTGTCGCCAGCGCCCGCGAGGCCCTG
GACCACATGGTGGAATATGTGGCCCAGAACACACCTGTCACGTGGCTCGTGGGACCCTTT
GCCCCTGGAATCACTGAGAAAGCCCCGGAGGAGAAGAAG
Restriction Sites Please inquire     
ACCN NM_001164189
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001164189.1, NP_001157661.1
RefSeq Size 2342 bp
RefSeq ORF 1302 bp
Locus ID 10226
UniProt ID O60664
Protein Families Druggable Genome
Gene Summary Mannose 6-phophate receptors (MPRs) deliver lysosomal hydrolase from the Golgi to endosomes and then return to the Golgi complex. The protein encoded by this gene interacts with the cytoplasmic domains of both cation-independent and cation-dependent MPRs, and is required for endosome-to-Golgi transport. This protein also binds directly to the GTPase RAB9 (RAB9A), a member of the RAS oncogene family. The interaction with RAB9 has been shown to increase the affinity of this protein for its cargo. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2009]
Transcript Variant: This variant (2) uses an alternate splice site in the 5' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...