PRKAR1B (NM_001164760) Human Untagged Clone
CAT#: SC327496
PRKAR1B (untagged)-Human protein kinase cAMP-dependent regulatory type I beta (PRKAR1B) transcript variant 5
CNY 7,220.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PRKAR1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001164760, the custom clone sequence may differ by one or more nucleotides
ATGGCCTCCCCGCCCGCCTGCCCCTCGGAGGAGGACGAGAGCCTGAAGGGCTGTGAGCTG TACGTGCAGCTGCACGGGATCCAGCAGGTCCTCAAAGACTGTATCGTCCACCTCTGCATC TCCAAGCCCGAACGCCCCATGAAGTTCCTCCGGGAGCACTTCGAGAAGCTGGAGAAGGAA GAAAACAGGCAGATTTTGGCGCGGCAAAAGTCAAACTCACAGTCGGACTCCCATGATGAG GAGGTGTCGCCCACCCCCCCGAACCCTGTGGTGAAGGCCCGCCGCCGGCGAGGAGGCGTG AGTGCCGAGGTGTACACCGAGGAGGACGCCGTGTCCTACGTCAGGAAGGTGATTCCCAAG GACTACAAAACCATGACTGCGCTGGCCAAGGCCATCTCCAAGAACGTGCTCTTCGCTCAC CTGGATGACAACGAGAGGAGTGACATATTCGATGCCATGTTCCCTGTCACTCACATCGCT GGGGAGACTGTTATACAGCAAGGGAATGAAGGAGACAACTTCTATGTCGTTGATCAAGGG GAAGTGGATGTGTACGTGAACGGAGAGTGGGTGACCAACATCAGCGAGGGAGGCAGCTTC GGGGAGCTGGCGCTCATCTACGGCACCCCCAGGGCTGCGACCGTGAAAGCCAAGACGGAC CTCAAGCTCTGGGGGATCGACCGGGACAGCTACCGGCGCATCCTTATGGGCAGCACGCTG AGGAAACGCAAGATGTACGAGGAGTTCCTCAGCAAGGTCTCCATCCTAGAGTCCCTGGAG AAGTGGGAGCGTCTGACCGTGGCGGATGCGCTGGAGCCCGTCCAGTTTGAAGATGGAGAG AAAATTGTGGTCCAGGGAGAGCCTGGGGACGACTTTTACATCATCACGGAGGGCACCGCG TCCGTGCTGCAGCGCCGGTCCCCCAATGAGGAGTACGTGGAGGTGGGGCGCCTGGGACCC TCTGACTACTTCGGGGAGATTGCACTGCTGCTGAACCGGCCCCGGGCGGCCACTGTCGTG GCCCGGGGGCCCCTCAAGTGTGTGAAGCTGGACCGGCCCCGCTTCGAGCGTGTGCTGGGG CCCTGCTCTGAGATCCTCAAGAGGAACATTCAGCGTTACAACAGCTTCATCTCCCTCACC GTC |
Restriction Sites | Please inquire |
ACCN | NM_001164760 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001164760.1, NP_001158232.1 |
RefSeq Size | 2533 bp |
RefSeq ORF | 1146 bp |
Locus ID | 5575 |
UniProt ID | P31321 |
Protein Families | Druggable Genome |
Protein Pathways | Apoptosis, Insulin signaling pathway |
Gene Summary | The protein encoded by this gene is a regulatory subunit of cyclic AMP-dependent protein kinase A (PKA), which is involved in the signaling pathway of the second messenger cAMP. Two regulatory and two catalytic subunits form the PKA holoenzyme, disbands after cAMP binding. The holoenzyme is involved in many cellular events, including ion transport, metabolism, and transcription. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2015] Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 1. All of the variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228861 | PRKAR1B (Myc-DDK-tagged)-Human protein kinase, cAMP-dependent, regulatory, type I, beta (PRKAR1B), transcript variant 5 |
CNY 3,656.00 |
|
RC228861L3 | Lenti-ORF clone of PRKAR1B (Myc-DDK-tagged)-Human protein kinase, cAMP-dependent, regulatory, type I, beta (PRKAR1B), transcript variant 5 |
CNY 5,890.00 |
|
RC228861L4 | Lenti-ORF clone of PRKAR1B (mGFP-tagged)-Human protein kinase, cAMP-dependent, regulatory, type I, beta (PRKAR1B), transcript variant 5 |
CNY 5,890.00 |
|
RG228861 | PRKAR1B (tGFP-tagged) - Human protein kinase, cAMP-dependent, regulatory, type I, beta (PRKAR1B), transcript variant 5 |
CNY 4,370.00 |
其它PRKAR1B产品