CD39 (ENTPD1) (NM_001164182) Human Untagged Clone
CAT#: SC327491
ENTPD1 (untagged)-Human ectonucleoside triphosphate diphosphohydrolase 1 (ENTPD1) transcript variant 6
CNY 6,080.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ATPDase; CD39; NTPDase-1; SPG64 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001164182, the custom clone sequence may differ by one or more nucleotides
ATGGAAAGTGAAGAGTTGGCAGACAGGGTTCTGGATGTGGTGGAGAGGAGCCTCAGCAAC TACCCCTTTGACTTCCAGGGTGCCAGGATCATTACTGGCCAAGAGGAAGGTGCCTATGGC TGGATTACTATCAACTATCTGCTGGGCAAATTCAGTCAGAAAACAAGGTGGTTCAGCATA GTCCCATATGAAACCAATAATCAGGAAACCTTTGGAGCTTTGGACCTTGGGGGAGCCTCT ACACAAGTCACTTTTGTACCCCAAAACCAGACTATCGAGTCCCCAGATAATGCTCTGCAA TTTCGCCTCTATGGCAAGGACTACAATGTCTACACACATAGCTTCTTGTGCTATGGGAAG GATCAGGCACTCTGGCAGAAACTGGCCAAGGACATTCAGGTTGCAAGTAATGAAATTCTC AGGGACCCATGCTTTCATCCTGGATATAAGAAGGTAGTGAACGTAAGTGACCTTTACAAG ACCCCCTGCACCAAGAGATTTGAGATGACTCTTCCATTCCAGCAGTTTGAAATCCAGGGT ATTGGAAACTATCAACAATGCCATCAAAGCATCCTGGAGCTCTTCAACACCAGTTACTGC CCTTACTCCCAGTGTGCCTTCAATGGGATTTTCTTGCCACCACTCCAGGGGGATTTTGGG GCATTTTCAGCTTTTTACTTTGTGATGAAGTTTTTAAACTTGACATCAGAGAAAGTCTCT CAGGAAAAGGTGACTGAGATGATGAAAAAGTTCTGTGCTCAGCCTTGGGAGGAGATAAAA ACATCTTACGCTGGAGTAAAGGAGAAGTACCTGAGTGAATACTGCTTTTCTGGTACCTAC ATTCTCTCCCTCCTTCTGCAAGGCTATCATTTCACAGCTGATTCCTGGGAGCACATCCAT TTCATTGGCAAGATCCAGGGCAGCGACGCCGGCTGGACTTTGGGCTACATGCTGAACCTG ACCAACATGATCCCAGCTGAGCAACCATTGTCCACACCTCTCTCCCACTCCACCTATGTC TTCCTCATGGTTCTATTCTCCCTGGTCCTTTTCACAGTGGCCATCATAGGCTTGCTTATC TTTCACAAGCCTTCATATTTCTGGAAAGATATGGTA |
Restriction Sites | Please inquire |
ACCN | NM_001164182 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001164182.1, NP_001157654.1 |
RefSeq Size | 12589 bp |
RefSeq ORF | 1119 bp |
Locus ID | 953 |
UniProt ID | P49961 |
Protein Families | Transmembrane |
Protein Pathways | Purine metabolism, Pyrimidine metabolism |
Gene Summary | The protein encoded by this gene is a plasma membrane protein that hydrolyzes extracellular ATP and ADP to AMP. Inhibition of this protein's activity may confer anticancer benefits. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015] Transcript Variant: This variant (6) lacks an alternate internal exon that results in a distinct 5' UTR and causes translation initiation at a downstream start codon, compared to variant 1. The encoded isoform (6) has a shorter N-terminus, compared to isoform 1. Both variants 6 and 7 encode the same isoform (6). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228856 | ENTPD1 (Myc-DDK-tagged)-Human ectonucleoside triphosphate diphosphohydrolase 1 (ENTPD1), transcript variant 6 |
CNY 3,990.00 |
|
RC228856L3 | Lenti-ORF clone of ENTPD1 (Myc-DDK-tagged)-Human ectonucleoside triphosphate diphosphohydrolase 1 (ENTPD1), transcript variant 6 |
CNY 5,890.00 |
|
RC228856L4 | Lenti-ORF clone of ENTPD1 (mGFP-tagged)-Human ectonucleoside triphosphate diphosphohydrolase 1 (ENTPD1), transcript variant 6 |
CNY 5,890.00 |
|
RG228856 | ENTPD1 (tGFP-tagged) - Human ectonucleoside triphosphate diphosphohydrolase 1 (ENTPD1), transcript variant 6 |
CNY 4,370.00 |