COPS7A (NM_001164093) Human Untagged Clone
CAT#: SC327428
COPS7A (untagged)-Human COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis) (COPS7A) transcript variant 1
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CSN7; CSN7A; SGN7a |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001164093, the custom clone sequence may differ by one or more nucleotides
ATGAGTGCGGAAGTGAAGGTGACAGGGCAGAACCAGGAGCAATTTCTGCTCCTAGCCAAG TCGGCCAAGGGGGCAGCGCTGGCCACACTCATCCATCAGGTGCTGGAGGCCCCTGGTGTC TACGTGTTTGGAGAACTGCTGGACATGCCCAATGTTAGAGAGCTGGCTGAGAGTGACTTT GCCTCTACCTTCCGGCTGCTCACAGTGTTTGCTTATGGGACATACGCTGACTACTTAGCT GAAGCCCGGAATCTTCCTCCACTAACAGAGGCTCAGAAGAATAAGCTTCGACACCTCTCA GTTGTCACCCTGGCTGCTAAAGTAAAGTGTATCCCATATGCAGTGTTGCTGGAGGCTCTT GCCCTGCGTAATGTGCGGCAGCTGGAAGACCTTGTGATTGAGGCTGTGTATGCTGACGTG CTTCGTGGCTCCCTGGACCAGCGCAACCAGCGGCTCGAGGTTGACTACAGCATCGGGCGG GACATCCAGCGCCAGGACCTCAGTGCCATTGCCCGAACCCTGCAGGAATGGTGTGTGGGC TGTGAGGTCGTGCTGTCAGGCATTGAGGAGCAGGTGAGCCGTGCCAACCAACACAAGGAG CAGCAGCTGGGCCTGAAGCAGCAGATTGAGAGTGAGGTTGCCAACCTTAAAAAAACCATT AAAGTTACGACGGCAGCAGCAGCCGCAGCCACATCTCAGGACCCTGAGCAACACCTGACT GAGCTGAGGGAACCAGCTCCTGGCACCAACCAGCGCCAGCCCAGCAAGAAAGCCTCAAAG GGCAAGGGGCTCCGAGGGAGCGCCAAGATTTGGTCCAAGTCGAAT |
Restriction Sites | Please inquire |
ACCN | NM_001164093 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001164093.1, NP_001157565.1 |
RefSeq Size | 2054 bp |
RefSeq ORF | 828 bp |
Locus ID | 50813 |
UniProt ID | Q9UBW8 |
Gene Summary | This gene encodes a component of the COP9 signalosome, an evolutionarily conserved multi-subunit protease that regulates the activity of the ubiquitin conjugation pathway. Alternatively spliced transcript variants that encode the same protein have been described. [provided by RefSeq, Mar 2014] Transcript Variant: This variant (1) represents the longest transcript. Variants 1-4 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228793 | COPS7A (Myc-DDK-tagged)-Human COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis) (COPS7A), transcript variant 1 |
CNY 2,400.00 |
|
RC228793L3 | Lenti-ORF clone of COPS7A (Myc-DDK-tagged)-Human COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis) (COPS7A), transcript variant 1 |
CNY 5,890.00 |
|
RC228793L4 | Lenti-ORF clone of COPS7A (mGFP-tagged)-Human COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis) (COPS7A), transcript variant 1 |
CNY 5,890.00 |
|
RG228793 | COPS7A (tGFP-tagged) - Human COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis) (COPS7A), transcript variant 1 |
CNY 4,370.00 |