CIKS (TRAF3IP2) (NM_001164283) Human Untagged Clone
CAT#: SC327359
TRAF3IP2 (untagged)-Human TRAF3 interacting protein 2 (TRAF3IP2) transcript variant 5
CN¥ 3,990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ACT1; C6orf2; C6orf4; C6orf5; C6orf6; CANDF8; CIKS; PSORS13 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001164283, the custom clone sequence may differ by one or more nucleotides
ATGATAATCGTAGCAATCAGCCCCAAATACAAACAGGACGTGGAAGGCGCTGAGTCGCAG CTGGACGAGGATGAGCATGGCTTACATACTAAGTACATTCATCGAATGATGCAGATTGAG TTCATAAAACAAGGAAGCATGAATTTCAGATTCATCCCTGTGCTCTTCCCAAATGCTAAG AAGGAGCATGTGCCCACCTGGCTTCAGAACACTCATGTCTACAGCTGGCCCAAGAATAAA AAAAACATCCTGCTGCGGCTGCTGAGAGAGGAAGAGTATGTGGCTCCTCCACGGGGGCCT CTGCCCACCCTTCAGGTGGTTCCCTTG |
Restriction Sites | Please inquire |
ACCN | NM_001164283 |
Insert Size | 4523 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001164283.1, NP_001157755.1 |
RefSeq Size | 4523 bp |
RefSeq ORF | 330 bp |
Locus ID | 10758 |
UniProt ID | O43734 |
Gene Summary | This gene encodes a protein involved in regulating responses to cytokines by members of the Rel/NF-kappaB transcription factor family. These factors play a central role in innate immunity in response to pathogens, inflammatory signals and stress. This gene product interacts with TRAF proteins (tumor necrosis factor receptor-associated factors) and either I-kappaB kinase or MAP kinase to activate either NF-kappaB or Jun kinase. Several alternative transcripts encoding different isoforms have been identified. Another transcript, which does not encode a protein and is transcribed in the opposite orientation, has been identified. Overexpression of this transcript has been shown to reduce expression of at least one of the protein encoding transcripts, suggesting it has a regulatory role in the expression of this gene. [provided by RefSeq, Aug 2009] Transcript Variant: This variant (5) lacks several exons from the 5' end, and contains an alternate 5' terminal exon compared to variant 2. This results in translation initiation from a downstream AUG, and a shorter isoform (5) compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228724 | TRAF3IP2 (Myc-DDK-tagged)-Human TRAF3 interacting protein 2 (TRAF3IP2), transcript variant 5 |
CN¥ 3,990.00 |
|
RC228724L3 | Lenti-ORF clone of TRAF3IP2 (Myc-DDK-tagged)-Human TRAF3 interacting protein 2 (TRAF3IP2), transcript variant 5 |
CN¥ 5,890.00 |
|
RC228724L4 | Lenti-ORF clone of TRAF3IP2 (mGFP-tagged)-Human TRAF3 interacting protein 2 (TRAF3IP2), transcript variant 5 |
CN¥ 5,890.00 |
|
RG228724 | TRAF3IP2 (tGFP-tagged) - Human TRAF3 interacting protein 2 (TRAF3IP2), transcript variant 5 |
CN¥ 4,370.00 |