NDUFS2 (NM_001166159) Human Untagged Clone
CAT#: SC327007
NDUFS2 (untagged)-Human NADH dehydrogenase (ubiquinone) Fe-S protein 2 49kDa (NADH-coenzyme Q reductase) (NDUFS2) nuclear gene encoding mitochondrial protein transcript variant 2
CNY 7,320.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CI-49; MC1DN6 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001166159, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCGCTGAGGGCTTTGTGCGGCTTCCGGGGCGTCGCGGCCCAGGTGCTGCGGCCT GGGGCTGGAGTCCGATTGCCGATTCAGCCCAGCAGAGGTGTTCGGCAGTGGCAGCCAGAT GTGGAATGGGCACAGCAGTTTGGGGGAGCTGTTATGTACCCAAGCAAAGAAACAGCCCAC TGGAAGCCTCCACCTTGGAATGATGTGGACCCTCCAAAGGACACAATTGTGAAGAACATT ACCCTGAACTTTGGGCCCCAACACCCAGCAGCGCATGGTGTCCTGCGACTAGTGATGGAA TTGAGTGGGGAGATGGTGCGGAAGTGTGATCCTCACATCGGGCTCCTGCACCGAGGCACT GAGAAGCTCATTGAATACAAGACCTATCTTCAGGCCCTTCCATACTTTGACCGGCTAGAC TATGTGTCCATGATGTGTAACGAACAGGCCTATTCTCTAGCTGTGGAGAAGTTGCTAAAC ATCCGGCCTCCTCCTCGGGCACAGTGGATCCGAGTGCTGTTTGGAGAAATCACACGTTTG TTGAACCACATCATGGCTGTGACCACACATGCCCTGGACCTTGGGGCCATGACCCCTTTC TTCTGGCTGTTTGAAGAAAGGGAGAAGATGTTTGAGTTCTACGAGCGAGTGTCTGGAGCC CGAATGCATGCTGCTTATATCCGGCCAGGAGGAGTGCACCAGGACCTACCCCTTGGGCTT ATGGATGACATTTATCAGTTTTCTAAGAACTTCTCTCTTCGGCTTGATGAGTTGGAGGAG TTGCTGACCAACAATAGGATCTGGCGAAATCGGACAATTGACATTGGGGTTGTAACAGCA GAAGAAGCACTTAACTATGGTTTTAGTGGAGTGATGCTTCGGGGCTCAGGCATCCAGTGG GACCTGCGGAAGACCCAGCCCTATGATGTTTACGACCAGGTTGAGTTTGATGTTCCTGTT GGTTCTCGAGGGGACTGCTATGATAGGTACCTGTGCCGGGTGGAGGAGATGCGCCAGTCC CTGAGAATTATCGCACAGTGTCTAAACAAGATGCCTCCTGGGGAGATCAAGGTTGATGAT GCCAAAGTGTCTCCACCTAAGCGAGCAGAGATGAAGACTTCCATGGAGTCACTGATTCAT CACTTTAAGTTGTATACTGAGGGCTACCAAGTTCCTCCAGGAGCCACATATACTGCCATT GAGGCTCCCAAGGGAGAGTTTGGGGTGTACCTGGTGTCTGATGGCAGCAGCCGCCCTTAT CGATGCAAGATCAAGGCTCCTGGTTTTGCCCATCTGGCTGGTTTGGACAAGATGTCTAAG GGACACATGTTGGCAGATGTCGTTGCCATCATAGGTACGAGGCCTATTGTG |
Restriction Sites | Please inquire |
ACCN | NM_001166159 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001166159.1, NP_001159631.1 |
RefSeq Size | 2082 bp |
RefSeq ORF | 1374 bp |
Locus ID | 4720 |
UniProt ID | O75306 |
Protein Pathways | Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
Gene Summary | The protein encoded by this gene is a core subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (complex I). Mammalian mitochondrial complex I is composed of at least 43 different subunits, 7 of which are encoded by the mitochondrial genome, and the rest are the products of nuclear genes. The iron-sulfur protein fraction of complex I is made up of 7 subunits, including this gene product. Complex I catalyzes the NADH oxidation with concomitant ubiquinone reduction and proton ejection out of the mitochondria. Mutations in this gene are associated with mitochondrial complex I deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009] Transcript Variant: This variant (2) differs at the 3' end compared to variant 1, resulting in a shorter isoform (2) with a distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228372 | NDUFS2 (Myc-DDK-tagged)-Human NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase) (NDUFS2), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 3,656.00 |
|
RC228372L3 | Lenti-ORF clone of NDUFS2 (Myc-DDK-tagged)-Human NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase) (NDUFS2), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5,990.00 |
|
RC228372L4 | Lenti-ORF clone of NDUFS2 (mGFP-tagged)-Human NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase) (NDUFS2), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 6,056.00 |
|
RG228372 | NDUFS2 (tGFP-tagged) - Human NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase) (NDUFS2), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 4,470.00 |