ER81 (ETV1) (NM_001163150) Human Untagged Clone
CAT#: SC326983
ETV1 (untagged)-Human ets variant 1 (ETV1) transcript variant 5
CNY 7,030.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ER81 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC326983 representing NM_001163150.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTTCAAGATTTAAGTGCAAGTGTCTTCTTTCCACCTTGTTCACAACACAGAACGTTAGCTCAGGTA CCTGACAATGATGAGCAGTTTGTACCAGACTATCAGGCTGAAAGTTTGGCTTTTCATGGCCTGCCACTG AAAATCAAGAAAGAACCCCACAGTCCATGTTCAGAAATCAGCTCTGCCTGCAGTCAAGAACAGCCCTTT AAATTCAGCTATGGAGAAAAGTGCCTGTACAATGTCAGTGCCTATGATCAGAAGCCACAAGTGGGAATG AGGCCCTCCAACCCCCCCACACCATCCAGCACGCCAGTGTCCCCACTGCATCATGCATCTCCAAACTCA ACTCATACACCGAAACCTGACCGGGCCTTCCCAGCTCACCTCCCTCCATCGCAGTCCATACCAGATAGC AGCTACCCCATGGACCACAGATTTCGCCGCCAGCTTTCTGAACCCTGTAACTCCTTTCCTCCTTTGCCG ACGATGCCAAGGGAAGGACGTCCTATGTACCAACGCCAGATGTCTGAGCCAAACATCCCCTTCCCACCA CAAGGCTTTAAGCAGGAGTACCACGACCCAGTGTATGAACACAACACCATGGTTGGCAGTGCGGCCAGC CAAAGCTTTCCCCCTCCTCTGATGATTAAACAGGAACCCAGAGATTTTGCATATGACTCAGAAGTGCCT AGCTGCCACTCCATTTATATGAGGCAAGAAGGCTTCCTGGCTCATCCCAGCAGAACAGAAGGCTGTATG TTTGAAAAGGGCCCCAGGCAGTTTTATGATGACACCTGTGTTGTCCCAGAAAAATTCGATGGAGACATC AAACAAGAGCCAGGAATGTATCGGGAAGGACCCACATACCAACGGCGAGGATCACTTCAGCTCTGGCAG TTTTTGGTAGCTCTTCTGGATGACCCTTCAAATTCTCATTTTATTGCCTGGACTGGTCGAGGCATGGAA TTTAAACTGATTGAGCCTGAAGAGGTGGCCCGACGTTGGGGCATTCAGAAAAACAGGCCAGCTATGAAC TATGATAAACTTAGCCGTTCACTCCGCTATTACTATGAGAAAGGAATTATGCAAAAGGTGGCTGGAGAG AGATATGTCTACAAGTTTGTGTGTGATCCAGAAGCCCTTTTCTCCATGGCCTTTCCAGATAATCAGCGT CCACTGCTGAAGACAGACATGGAACGTCACATCAACGAGGAGGACACAGTGCCTCTTTCTCACTTTGAT GAGAGCATGGCCTACATGCCGGAAGGGGGCTGCTGCAACCCCCACCCCTACAACGAAGGCTACGTGTAT TAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001163150 |
Insert Size | 1314 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001163150.1 |
RefSeq Size | 6303 bp |
RefSeq ORF | 1314 bp |
Locus ID | 2115 |
UniProt ID | P50549 |
Protein Families | ES Cell Differentiation/IPS, Transcription Factors |
MW | 50.2 kDa |
Gene Summary | This gene encodes a member of the ETS (E twenty-six) family of transcription factors. The ETS proteins regulate many target genes that modulate biological processes like cell growth, angiogenesis, migration, proliferation and differentiation. All ETS proteins contain an ETS DNA-binding domain that binds to DNA sequences containing the consensus 5'-CGGA[AT]-3'. The protein encoded by this gene contains a conserved short acidic transactivation domain (TAD) in the N-terminal region, in addition to the ETS DNA-binding domain in the C-terminal region. This gene is involved in chromosomal translocations, which result in multiple fusion proteins including EWS-ETV1 in Ewing sarcoma and at least 10 ETV1 partners (see PMID: 19657377, Table 1) in prostate cancer. In addition to chromosomal rearrangement, this gene is overexpressed in prostate cancer, melanoma and gastrointestinal stromal tumor. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2016] Transcript Variant: This variant (5) represents use of an alternate promoter, 5' UTR, and 5' coding region, compared to variant 1. The resulting isoform (d) has a shorter and distinct N-terminus, compared to isoform a. This isoform lacks major part of the N-terminal TAD. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228348 | ETV1 (Myc-DDK-tagged)-Human ets variant 1 (ETV1), transcript variant 5 |
CNY 5,488.00 |
|
RC228348L3 | Lenti ORF clone of Human ets variant 1 (ETV1), transcript variant 5, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC228348L4 | Lenti ORF clone of Human ets variant 1 (ETV1), transcript variant 5, mGFP tagged |
CNY 5,890.00 |
|
RG228348 | ETV1 (tGFP-tagged) - Human ets variant 1 (ETV1), transcript variant 5 |
CNY 7,088.00 |