United States
Germany
Japan
United Kingdom
China
SHOX2 (NM_001163678) Human Untagged Clone
CAT＃: SC326888
SHOX2 (untagged)-Human short stature homeobox 2 (SHOX2) transcript variant 3
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | OG12; OG12X; SHOT |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC326888 representing NM_001163678.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAAGAACTTACGGCGTTCGTCTCCAAGTCTTTTGACCAGAAAGTGAAGGAGAAGAAGGAGGCGATC ACGTACCGGGAGGTGCTGGAGAGCGGGCCGCTGCGCGGGGCCAAGGAGCCGACCGGCTGCACCGAGGCG GGCCGCGACGACCGCAGCAGCCCGGCAGTCCGGGCGGCCGGCGGAGGCGGCGGCGGAGGAGGCGGAGGC GGCGGCGGAGGAGGCGGAGGAGGTGTAGGAGGAGGAGGAGCAGGCGGAGGAGCTGGAGGAGGGCGCTCT CCCGTCCGGGAGCTGGACATGGGCGCCGCCGAGAGAAGCAGGGAGCCGGGCAGCCCGCGACTGACGGAG GTGTCCCCGGAGCTGAAAGATCGCAAAGAGGATGCGAAAGGGATGGAGGACGAAGGCCAGACCAAAATC AAGCAGAGGCGAAGTCGGACCAATTTCACCCTGGAACAACTCAATGAGCTGGAGAGGCTTTTTGACGAG ACCCACTATCCCGACGCCTTCATGCGAGAGGAACTGAGCCAGCGACTGGGCCTGTCGGAGGCCCGAGTG CAGGTTTGGTTTCAAAATCGAAGAGCTAAATGTAGAAAACAAGAAAATCAACTCCATAAAGGTGTTCTC ATAGGGGCCGCCAGCCAGTTTGAAGCTTGTAGAGTCGCACCTTATGTCAACGTAGGTGCTTTAAGGATG CCATTTCAGCAGGTTCAGGCGCAGCTGCAGCTGGACAGCGCTGTGGCGCACGCGCACCACCACCTGCAT CCGCACCTGGCCGCGCACGCGCCCTACATGATGTTCCCAGCACCGCCCTTCGGACTGCCGCTCGCCACG CTGGCCGCGGATTCGGCTTCCGCCGCCTCGGTAGTGGCGGCCGCAGCAGCCGCCAAGACCACCAGCAAG AACTCCAGCATCGCCGATCTCAGACTGAAAGCCAAAAAGCACGCCGCAGCCCTGGGTCTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001163678 |
| Insert Size | 960 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001163678.1 |
| RefSeq Size | 3125 bp |
| RefSeq ORF | 960 bp |
| Locus ID | 6474 |
| UniProt ID | O60902 |
| Protein Families | Transcription Factors |
| MW | 33.6 kDa |
| Gene Summary | This gene is a member of the homeobox family of genes that encode proteins containing a 60-amino acid residue motif that represents a DNA binding domain. Homeobox genes have been characterized extensively as transcriptional regulators involved in pattern formation in both invertebrate and vertebrate species. Several human genetic disorders are caused by aberrations in human homeobox genes. This locus represents a pseudoautosomal homeobox gene that is thought to be responsible for idiopathic short stature, and it is implicated in the short stature phenotype of Turner syndrome patients. This gene is considered to be a candidate gene for Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009] Transcript Variant: This variant (3) lacks an alternate in-frame exon and uses an alternate in-frame splice site in the coding region, compared to variant 1, resulting in an isoform (c) that is shorter than isoform b. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228253 | SHOX2 (Myc-DDK-tagged)-Human short stature homeobox 2 (SHOX2), transcript variant 3 |
CNY 2,400.00 |
|
| RC228253L1 | Lenti ORF clone of Human short stature homeobox 2 (SHOX2), transcript variant 3, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC228253L2 | Lenti ORF clone of Human short stature homeobox 2 (SHOX2), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RC228253L3 | Lenti ORF clone of Human short stature homeobox 2 (SHOX2), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC228253L4 | Lenti ORF clone of Human short stature homeobox 2 (SHOX2), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RG228253 | SHOX2 (tGFP-tagged) - Human short stature homeobox 2 (SHOX2), transcript variant 3 |
CNY 4,370.00 |
