Aspartate beta hydroxylase (ASPH) (NM_001164751) Human Untagged Clone
CAT#: SC326866
ASPH (untagged)-Human aspartate beta-hydroxylase (ASPH) transcript variant 7
CN¥ 6,270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AAH; BAH; CASQ2BP1; FDLAB; HAAH; JCTN; junctin |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001164751, the custom clone sequence may differ by one or more nucleotides
ATGGCTGAAGATAAAGAGACAAAGCATGGAGGACACAAGAATGGGAGGAAAGGCGGACTC TCAGGAACTTCATTCTTCACGTGGTTTATGGTGATTGCATTGCTGGGCGTCTGGACATCT GTAGCTGTCGTTTGGTTTGATCTTGTTGACTATGAGGAAGTTCTAGCCAAAGCAAAGGAC TTCCGTTATAACTTATCAGAGGTGCTTCAAGGAAAACTAGGAATCTATGATGCTGATGGT GATGGAGATTTTGATGTGGATGATGCCAAAGTTTTATTAGGACTTAAAGAGAGATCTACT TCAGAGCCAGCAGTCCCGCCAGAAGAGGCTGAGCCACACACTGAGCCCGAGGAGCAGGTT CCTGTGGAGGCAGAACCCCAGAATATCGAAGATGAAGCAAAAGAACAAATTCAGTCCCTT CTCCATGAAATGGTACACGCAGAACATGTTGAGGGAGAAGACTTGCAACAAGAAGATGGA CCCACAGGAGAACCACAACAAGAGGATGATGAGTTTCTTATGGCGACTGATGTAGATGAT AGATTTGAGACCCTGGAACCTGAAGTATCTCATGAAGAAACCGAGCATAGTTACCACGTG GAAGAGACAGTTTCACAAGACTGTAATCAGGATATGGAAGAGATGATGTCTGAGCAGGAA AATCCAGATTCCAGTGAACCAGTAGTAGAAGATGAAAGATTGCACCATGATACAGATGAT GTAACATACCAAGTCTATGAGGAACAAGTATATGAACCTCTAGAAAATGAAGGGATAGAA ATCACAGAAGTAACTGCTCCCCCTGAGGATAATCCTGTAGAAGATTCACAGGTAATTGTA GAAGAAGTAAGCATTTTTCCTGTGGAAGAACAGCAGGAAGTACCACCAGATACT |
Restriction Sites | Please inquire |
ACCN | NM_001164751 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001164751.1, NP_001158223.1 |
RefSeq Size | 3639 bp |
RefSeq ORF | 897 bp |
Locus ID | 444 |
UniProt ID | Q12797 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene is thought to play an important role in calcium homeostasis. The gene is expressed from two promoters and undergoes extensive alternative splicing. The encoded set of proteins share varying amounts of overlap near their N-termini but have substantial variations in their C-terminal domains resulting in distinct functional properties. The longest isoforms (a and f) include a C-terminal Aspartyl/Asparaginyl beta-hydroxylase domain that hydroxylates aspartic acid or asparagine residues in the epidermal growth factor (EGF)-like domains of some proteins, including protein C, coagulation factors VII, IX, and X, and the complement factors C1R and C1S. Other isoforms differ primarily in the C-terminal sequence and lack the hydroxylase domain, and some have been localized to the endoplasmic and sarcoplasmic reticulum. Some of these isoforms are found in complexes with calsequestrin, triadin, and the ryanodine receptor, and have been shown to regulate calcium release from the sarcoplasmic reticulum. Some isoforms have been implicated in metastasis. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (7) represents use of an alternate promoter and 5' UTR and uses a distinct start codon, uses a distinct 3' splice pattern that lacks many coding exons, includes an alternate in-frame exon and uses an alternate in-frame splice site, compared to variant 1. The resulting isoform (g) has a shorter and distinct N-terminus a substantially shorter and distinct C-terminus, and several internal differences, compared to isoform a. This isoform is similar to isoform b, which is also known as junctate. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228231 | ASPH (Myc-DDK-tagged)-Human aspartate beta-hydroxylase (ASPH), transcript variant 7 |
CN¥ 2,400.00 |
|
RC228231L3 | Lenti-ORF clone of ASPH (Myc-DDK-tagged)-Human aspartate beta-hydroxylase (ASPH), transcript variant 7 |
CN¥ 5,890.00 |
|
RC228231L4 | Lenti-ORF clone of ASPH (mGFP-tagged)-Human aspartate beta-hydroxylase (ASPH), transcript variant 7 |
CN¥ 5,890.00 |
|
RG228231 | ASPH (tGFP-tagged) - Human aspartate beta-hydroxylase (ASPH), transcript variant 7 |
CN¥ 4,370.00 |
其它Aspartate beta hydroxylase产品