United States
Germany
Japan
United Kingdom
China
CDK5 (NM_001164410) Human Untagged Clone
CAT＃: SC326832
CDK5 (untagged)-Human cyclin-dependent kinase 5 (CDK5) transcript variant 2
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
热销推荐Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | LIS7; PSSALRE |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC326832 representing NM_001164410.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCAGAAATACGAGAAACTGGAAAAGATTGGGGAAGGCACCTACGGAACTGTGTTCAAGGCCAAAAAC CGGGAGACTCATGAGATCGTGGCTCTGAAACGGGTGAGGCTGGATGACGATGATGAGGGTGTGCCGAGT TCCGCCCTCCGGGAGATCTGCCTACTCAAGGAGCTGAAGCACAAGAACATCGTCAGGCTTCATGACGTC CTGCACAGCGACAAGAAGCTGACTTTGGTTTTTGAATTCTGTGACCAGGACCTGAAGAAGTATTTTGAC AGTTGCAATGGTGACCTCGATCCTGAGATTGTAAAGAATGGGGAGCTGAAATTGGCTGATTTTGGCCTG GCTCGAGCCTTTGGGATTCCCGTCCGCTGTTACTCAGCTGAGGTGGTCACACTGTGGTACCGCCCACCG GATGTCCTCTTTGGGGCCAAGCTGTACTCCACGTCCATCGACATGTGGTCAGCCGGCTGCATCTTTGCA GAGCTGGCCAATGCTGGGCGGCCTCTTTTTCCCGGCAATGATGTCGATGACCAGTTGAAGAGGATCTTC CGACTGCTGGGGACGCCCACCGAGGAGCAGTGGCCCTCTATGACCAAGCTGCCAGACTATAAGCCCTAT CCGATGTACCCGGCCACAACATCCCTGGTGAACGTCGTGCCCAAACTCAATGCCACAGGGAGGGATCTG CTGCAGAACCTTCTGAAGTGTAACCCTGTCCAGCGTATCTCAGCAGAAGAGGCCCTGCAGCACCCCTAC TTCTCCGACTTCTGTCCGCCCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001164410 |
| Insert Size | 783 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001164410.2 |
| RefSeq Size | 1115 bp |
| RefSeq ORF | 783 bp |
| Locus ID | 1020 |
| UniProt ID | Q00535 |
| Protein Families | Druggable Genome, Protein Kinase |
| Protein Pathways | Alzheimer's disease, Axon guidance |
| MW | 29.5 kDa |
| Gene Summary | This gene encodes a proline-directed serine/threonine kinase that is a member of the cyclin-dependent kinase family of proteins. Unlike other members of the family, the protein encoded by this gene does not directly control cell cycle regulation. Instead the protein, which is predominantly expressed at high levels in mammalian postmitotic central nervous system neurons, functions in diverse processes such as synaptic plasticity and neuronal migration through phosphorylation of proteins required for cytoskeletal organization, endocytosis and exocytosis, and apoptosis. In humans, an allelic variant of the gene that results in undetectable levels of the protein has been associated with lethal autosomal recessive lissencephaly-7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015] Transcript Variant: This variant (2), also known as CDK5-SV, omits an in-frame coding exon compared to variant 1 resulting in a shorter predicted protein (isoform 2). Expression of this transcript was described by Li et al. (2009; PubMed ID 19693690). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228197 | CDK5 (Myc-DDK-tagged)-Human cyclin-dependent kinase 5 (CDK5), transcript variant 2 |
CNY 2,400.00 |
|
| RC228197L1 | Lenti ORF clone of Human cyclin-dependent kinase 5 (CDK5), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC228197L2 | Lenti ORF clone of Human cyclin-dependent kinase 5 (CDK5), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RC228197L3 | Lenti ORF clone of Human cyclin-dependent kinase 5 (CDK5), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC228197L4 | Lenti ORF clone of Human cyclin-dependent kinase 5 (CDK5), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG228197 | CDK5 (tGFP-tagged) - Human cyclin-dependent kinase 5 (CDK5), transcript variant 2 |
CNY 4,370.00 |
