SLAMF9 (NM_001146172) Human Untagged Clone
CAT#: SC326764
SLAMF9 (untagged)-Human SLAM family member 9 (SLAMF9) transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD2F-10; CD2F10; CD84-H1; CD84H1; SF2001 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001146172, the custom clone sequence may differ by one or more nucleotides
ATGTGTGCCTTTCCTTGGCTGCTTCTTCTCCTGCTGCTCCAGGAGGGCAGCCAAAGGAGA CTCTGGAGATGGTGTGGATCCGAGGAAGTGGTTGCGGTCCTTCAGGAGTCCATCAGCCTC CCCCTGGAAATACCACCAGATGAAGAGGTTGAGAACATCATCTGGTCCTCTCACAAAAGT CTTGCCACTGTGGTGCCAGGGAAAGAGGGACATCCAGCTACCATCATGGTGACCAATCCA CACTACCAGGGCCAAGTGAGCTTCCTGGACCCCAGCTATTCCCTGCATATCAGCAATCTG AGCTGGGAGGATTCAGGGCTTTACCAAGCTCAAGTCAACCTGAGAACATCCCAGATCTCT ACCATGCAGCAGTACAATATATGTGTCTACCATCCTAACTATGCTTCTGAGAAGCCTTCA ACAGCCTTCTGCCTCCTGGCCAAGGGATTGCTCATCTTCTTGCTCTTGGTAATTCTGGCC ATGGGACTCTGGGTCATCCGAGTCCAGAAAAGACACAAAATGCCAAGGATGAAGAAACTC ATGAGAAACAGAATGAAATTGAGGAAGGAGGCAAAGCCTGGCTCCAGCCCTGCC |
Restriction Sites | Please inquire |
ACCN | NM_001146172 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001146172.1, NP_001139644.1 |
RefSeq Size | 897 bp |
RefSeq ORF | 597 bp |
Locus ID | 89886 |
UniProt ID | Q96A28 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a member of the signaling lymphocytic activation molecule family. The encoded protein is a cell surface molecule that consists of two extracellular immunoglobulin domains, a transmembrane domain and a short cytoplasmic tail that lacks the signal transduction motifs found in other family members. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Apr 2009] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the coding region compared to variant 1. The encoded isoform (2) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228129 | SLAMF9 (Myc-DDK-tagged)-Human SLAM family member 9 (SLAMF9), transcript variant 2 |
CNY 3,990.00 |
|
RC228129L3 | Lenti-ORF clone of SLAMF9 (Myc-DDK-tagged)-Human SLAM family member 9 (SLAMF9), transcript variant 2 |
CNY 5,890.00 |
|
RC228129L4 | Lenti-ORF clone of SLAMF9 (mGFP-tagged)-Human SLAM family member 9 (SLAMF9), transcript variant 2 |
CNY 5,890.00 |
|
RG228129 | SLAMF9 (tGFP-tagged) - Human SLAM family member 9 (SLAMF9), transcript variant 2 |
CNY 4,370.00 |