United States
Germany
Japan
United Kingdom
China
DPYD (NM_001160301) Human Untagged Clone
CAT＃: SC326747
DPYD (untagged)-Human dihydropyrimidine dehydrogenase (DPYD) transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DHP; DHPDHASE; DPD |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001160301, the custom clone sequence may differ by one or more nucleotides
ATGGCCCCTGTGCTCAGTAAGGACTCGGCGGACATCGAGAGTATCCTGGCTTTAAATCCT CGAACACAAACTCATGCAACTCTGTGTTCCACTTCGGCCAAGAAATTAGACAAGAAACAT TGGAAAAGAAATCCTGATAAGAACTGCTTTAATTGTGAGAAGCTGGAGAATAATTTTGAT GACATCAAGCACACGACTCTTGGTGAGCGAGGAGCTCTCCGAGAAGCAATGAGATGCCTG AAATGTGCAGATGCCCCGTGTCAGAAGAGCTGTCCAACTAATCTTGATATTAAATCATTC ATCACAAGTATTGCAAACAAGAACTATTATGGAGCTGCTAAGATGATATTTTCTGACAAC CCACTTGGTCTGACTTGTGGAATGGTATGTCCAACCTCTGATCTTTGTGTAGGTGGATGC AATTTATATGCCACTGAAGAGGGACCCATTAATATTGGTGGATTGCAGCAATTTGCTACT GAGACTTTGATCCTGGCTTTCTCTTTAATGAATCATTTG |
| Restriction Sites | Please inquire |
| ACCN | NM_001160301 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001160301.1, NP_001153773.1 |
| RefSeq Size | 1789 bp |
| RefSeq ORF | 522 bp |
| Locus ID | 1806 |
| UniProt ID | Q12882 |
| Protein Families | Druggable Genome |
| Protein Pathways | beta-Alanine metabolism, Drug metabolism - other enzymes, Metabolic pathways, Pantothenate and CoA biosynthesis, Pyrimidine metabolism |
| Gene Summary | The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009] Transcript Variant: This variant (2) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228112 | DPYD (Myc-DDK-tagged)-Human dihydropyrimidine dehydrogenase (DPYD), transcript variant 2 |
CNY 3,990.00 |
|
| RC228112L3 | Lenti-ORF clone of DPYD (Myc-DDK-tagged)-Human dihydropyrimidine dehydrogenase (DPYD), transcript variant 2 |
CNY 5,890.00 |
|
| RC228112L4 | Lenti-ORF clone of DPYD (mGFP-tagged)-Human dihydropyrimidine dehydrogenase (DPYD), transcript variant 2 |
CNY 5,890.00 |
|
| RG228112 | DPYD (tGFP-tagged) - Human dihydropyrimidine dehydrogenase (DPYD), transcript variant 2 |
CNY 4,370.00 |
