United States
Germany
Japan
United Kingdom
China
H2BC18 (NM_001161334) Human Untagged Clone
CAT＃: SC326710
HIST2H2BF (untagged)-Human histone cluster 2 H2bf (HIST2H2BF) transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HIST2H2BF |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001161334, the custom clone sequence may differ by one or more nucleotides
ATGCCGGATCCAGCGAAATCCGCTCCTGCTCCCAAGAAGGGCTCCAAAAAGGCTGTTACG AAAGTGCAGAAGAAGGACGGCAAGAAGCGCAAGCGCAGCCGCAAGGAGAGCTACTCCGTT TACGTGTACAAGGTGCTGAAGCAGGTCCACCCCGACACCGGCATCTCGTCCAAGGCCATG GGCATCATGAACTCCTTCGTCAACGACATCTTCGAGCGCATCGCGGGAGAGGCGTCCCGC CTGGCGCACTACAACAAGCGCTCCACCATCACATCCCGCGAGATCCAGACGGCCGTGCGC CTGCTGCTGCCCGGCGAGCTGGCCAAGCACGCCGTGTCCGAGGGCACCAAGGCGGTCACC AAGTACACCAGCTCGAAGTTAATAGGACCCATCCTTTGGAAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001161334 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001161334.1, NP_001154806.1 |
| RefSeq Size | 999 bp |
| RefSeq ORF | 405 bp |
| Locus ID | 440689 |
| UniProt ID | Q5QNW6 |
| Protein Pathways | Systemic lupus erythematosus |
| Gene Summary | Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-dependent histone that is a member of the histone H2B family and is found in a histone cluster on chromosome 1. [provided by RefSeq, Aug 2015] Transcript Variant: This variant (2) encodes the longer isoform (b). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228075 | HIST2H2BF (Myc-DDK-tagged)-Human histone cluster 2, H2bf (HIST2H2BF), transcript variant 2 |
CNY 3,990.00 |
|
| RC228075L3 | Lenti-ORF clone of HIST2H2BF (Myc-DDK-tagged)-Human histone cluster 2, H2bf (HIST2H2BF), transcript variant 2 |
CNY 5,890.00 |
|
| RC228075L4 | Lenti-ORF clone of HIST2H2BF (mGFP-tagged)-Human histone cluster 2, H2bf (HIST2H2BF), transcript variant 2 |
CNY 5,890.00 |
|
| RG228075 | HIST2H2BF (tGFP-tagged) - Human histone cluster 2, H2bf (HIST2H2BF), transcript variant 2 |
CNY 4,370.00 |
