United States
Germany
Japan
United Kingdom
China
NCR3 (NM_001145467) Human Untagged Clone
CAT＃: SC326537
NCR3 (untagged)-Human natural cytotoxicity triggering receptor 3 (NCR3), transcript variant 3, mRNA
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1C7; CD337; LY117; MALS; NKp30 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC326537 representing NM_001145467.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCTGGATGCTGTTGCTCATCTTGATCATGGTCCATCCAGGATCCTGTGCTCTCTGGGTGTCCCAG CCCCCTGAGATTCGTACCCTGGAAGGATCCTCTGCCTTCCTGCCCTGCTCCTTCAATGCCAGCCAAGGG AGACTGGCCATTGGCTCCGTCACGTGGTTCCGAGATGAGGTGGTTCCAGGGAAGGAGGTGAGGAATGGA ACCCCAGAGTTCAGGGGCCGCCTGGCCCCACTTGCTTCTTCCCGTTTCCTCCATGACCACCAGGCTGAG CTGCACATCCGGGACGTGCGAGGCCATGACGCCAGCATCTACGTGTGCAGAGTGGAGGTGCTGGGCCTT GGTGTCGGGACAGGGAATGGGACTCGGCTGGTGGTGGAGAAAGAACATCCTCAGCTAGGGGCTGGTACA GTCCTCCTCCTTCGGGCTGGATTCTATGCTGTCAGCTTTCTCTCTGTGGCCGTGGGCAGCACCGTCTAT TACCAGGGCAAATGCCACTGTCACATGGGAACACACTGCCACTCCTCAGATGGGCCCCGAGGAGTGATT CCAGAGCCCAGATGTCCCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001145467 |
| Insert Size | 573 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001145467.1 |
| RefSeq Size | 875 bp |
| RefSeq ORF | 573 bp |
| Locus ID | 259197 |
| UniProt ID | O14931 |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS |
| Protein Pathways | Natural killer cell mediated cytotoxicity |
| MW | 20.6 kDa |
| Gene Summary | The protein encoded by this gene is a natural cytotoxicity receptor (NCR) that may aid NK cells in the lysis of tumor cells. The encoded protein interacts with CD3-zeta (CD247), a T-cell receptor. A single nucleotide polymorphism in the 5' untranslated region of this gene has been associated with mild malaria suceptibility. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010] Transcript Variant: This variant (3) uses an alternate splice site in the 3' coding region compared to variant 1, that results in a frameshift. It encodes isoform c, which has a shorter and distinct C-terminus compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227395 | NCR3 (Myc-DDK-tagged)-Human natural cytotoxicity triggering receptor 3 (NCR3), transcript variant 3 |
CNY 2,400.00 |
|
| RC227395L1 | Lenti ORF clone of Human natural cytotoxicity triggering receptor 3 (NCR3), transcript variant 3, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC227395L2 | Lenti ORF clone of Human natural cytotoxicity triggering receptor 3 (NCR3), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RC227395L3 | Lenti ORF clone of Human natural cytotoxicity triggering receptor 3 (NCR3), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC227395L4 | Lenti ORF clone of Human natural cytotoxicity triggering receptor 3 (NCR3), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RG227395 | NCR3 (tGFP-tagged) - Human natural cytotoxicity triggering receptor 3 (NCR3), transcript variant 3 |
CNY 4,370.00 |
