HOPX (NM_001145459) Human Untagged Clone
CAT#: SC326443
HOPX (untagged)-Human HOP homeobox (HOPX), transcript variant 4, mRNA
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CAMEO; HOD; HOP; LAGY; NECC1; OB1; SMAP31; TOTO |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001145459, the custom clone sequence may differ by one or more nucleotides
ATGTCGGCGGAGACCGCGAGCGGCCCCACAGAGGACCAGGTGGAAATCCTGGAGTACAAC TTCAACAAGGTCGACAAGCACCCGGATTCCACCACGCTGTGCCTCATCGCGGCCGAGGCA GGCCTTTCCGAGGAGGAGACCCAGAAATGGTTTAAGCAGCGCCTGGCAAAGTGGCGGCGC TCAGAAGGCCTGCCCTCAGAGTGCAGATCCGTCACAGAC |
Restriction Sites | Please inquire |
ACCN | NM_001145459 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001145459.1, NP_001138931.1 |
RefSeq Size | 1198 bp |
RefSeq ORF | 222 bp |
Locus ID | 84525 |
UniProt ID | Q9BPY8 |
Protein Families | Transcription Factors |
Gene Summary | The protein encoded by this gene is a homeodomain protein that lacks certain conserved residues required for DNA binding. It was reported that choriocarcinoma cell lines and tissues failed to express this gene, which suggested the possible involvement of this gene in malignant conversion of placental trophoblasts. Studies in mice suggest that this protein may interact with serum response factor (SRF) and modulate SRF-dependent cardiac-specific gene expression and cardiac development. Multiple alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Feb 2009] Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region and uses a downstream translational start codon, compared to variant 1. The resulting isoform (b) is shorter at the N-terminus, compared to isoform a. Variants 2, 3 and 4 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227611 | HOPX (Myc-DDK-tagged)-Human HOP homeobox (HOPX), transcript variant 4 |
CNY 1,200.00 |
|
RC227611L3 | Lenti-ORF clone of HOPX (Myc-DDK-tagged)-Human HOP homeobox (HOPX), transcript variant 4 |
CNY 5,890.00 |
|
RC227611L4 | Lenti-ORF clone of HOPX (mGFP-tagged)-Human HOP homeobox (HOPX), transcript variant 4 |
CNY 5,890.00 |
|
RG227611 | HOPX (tGFP-tagged) - Human HOP homeobox (HOPX), transcript variant 4 |
CNY 4,370.00 |