uPA (PLAU) (NM_001145031) Human Untagged Clone

CAT#: SC325894

PLAU (untagged)-Human plasminogen activator, urokinase (PLAU), transcript variant 2



  "NM_001145031" in other vectors (4)

CNY 3,656.00

CNY 6,650.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
PLAU mouse monoclonal antibody, clone OTI5H4 (formerly 5H4)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ATF; BDPLT5; QPD; u-PA; UPA; URK
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001145031 edited
ATGGTCTTCCATTTGAGAACTAGATACGAACAGGCGAACTGTGACTGTCTAAATGGAGGA
ACATGTGTGTCCAACAAGTACTTCTCCAACATTCACTGGTGCAACTGCCCAAAGAAATTC
GGAGGGCAGCACTGTGAAATAGATAAGTCAAAAACCTGCTATGAGGGGAATGGTCACTTT
TACCGAGGAAAGGCCAGCACTGACACCATGGGCCGGCCCTGCCTGCCCTGGAACTCTGCC
ACTGTCCTTCAGCAAACGTACCATGCCCACAGATCTGATGCTCTTCAGCTGGGCCTGGGG
AAACATAATTACTGCAGGAACCCAGACAACCGGAGGCGACCCTGGTGCTATGTGCAGGTG
GGCCTAAAGCCGCTTGTCCAAGAGTGCATGGTGCATGACTGCGCAGATGGAAAAAAGCCC
TCCTCTCCTCCAGAAGAATTAAAATTTCAGTGTGGCCAAAAGACTCTGAGGCCCCGCTTT
AAGATTATTGGGGGAGAATTCACCACCATCGAGAACCAGCCCTGGTTTGCGGCCATCTAC
AGGAGGCACCGGGGGGGCTCTGTCACCTACGTGTGTGGAGGCAGCCTCATCAGCCCTTGC
TGGGTGATCAGCGCCACACACTGCTTCATTGATTACCCAAAGAAGGAGGACTACATCGTC
TACCTGGGTCGCTCAAGGCTTAACTCCAACACGCAAGGGGAGATGAAGTTTGAGGTGGAA
AACCTCATCCTACACAAGGACTACAGCGCTGACACGCTTGCTCACCACAACGACATTGCC
TTGCTGAAGATCCGTTCCAAGGAGGGCAGGTGTGCGCAGCCATCCCGGACTATACAGACC
ATCTGCCTGCCCTCGATGTATAACGATCCCCAGTTTGGCACAAGCTGTGAGATCACTGGC
TTTGGAAAAGAGAATTCTACCGACTATCTCTATCCGGAGCAGCTGAAAATGACTGTTGTG
AAGCTGATTTCCCACCGGGAGTGTCAGCAGCCCCACTACTACGGCTCTGAAGTCACCACC
AAAATGCTGTGTGCTGCTGACCCACAGTGGAAAACAGATTCCTGCCAGGGAGACTCAGGG
GGACCCCTCGTCTGTTCCCTCCAAGGCCGCATGACTTTGACTGGAATTGTGAGCTGGGGC
CGTGGATGTGCCCTGAAGGACAAGCCAGGCGTCTACACGAGAGTCTCACACTTCTTACCC
TGGATCCGCAGTCACACCAAGGAAGAGAATGGCCTGGCCCTCTGA
Restriction Sites Please inquire     
ACCN NM_001145031
Insert Size 1300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001145031.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001145031.1, NP_001138503.1
RefSeq Size 2680 bp
RefSeq ORF 1245 bp
Locus ID 5328
UniProt ID P00749
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Protease
Protein Pathways Complement and coagulation cascades
Gene Summary This gene encodes a secreted serine protease that converts plasminogen to plasmin. The encoded preproprotein is proteolytically processed to generate A and B polypeptide chains. These chains associate via a single disulfide bond to form the catalytically inactive high molecular weight urokinase-type plasminogen activator (HMW-uPA). HMW-uPA can be further processed into the catalytically active low molecular weight urokinase-type plasminogen activator (LMW-uPA). This low molecular weight form does not bind to the urokinase-type plasminogen activator receptor. Mutations in this gene may be associated with Quebec platelet disorder and late-onset Alzheimer's disease. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start site compared to variant 1. The encoded isoform (2) has a shorter and distinct N-terminus, and lacks a predicted signal peptide compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...