FZR1 (NM_001136197) Human Untagged Clone

CAT#: SC325888

FZR1 (untagged)-Human fizzy/cell division cycle 20 related 1 (Drosophila) (FZR1), transcript variant 3



  "NM_001136197" in other vectors (4)

CNY 6,560.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-FZR1
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CDC20C; CDH1; FZR; FZR2; HCDH; HCDH1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325888 representing NM_001136197.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACCAGGACTATGAGCGGCGCCTGCTTCGCCAGATCGTCATCCAGAATGAGAACACGATGCCACGC
GTCACAGAGATGCGGCGGACCCTGACGCCTGCCAGCTCCCCAGTGTCCTCGCCCAGCAAGCACGGAGAC
CGCTTCATCCCCTCCAGAGCCGGAGCCAACTGGAGCGTGAACTTCCACAGGATTAACGAGAATGAGAAG
TCTCCCAGTCAGAACCGGAAAGCCAAGGACGCCACCTCAGACAACGGCAAAGACGGCCTGGCCTACTCT
GCCCTGCTCAAGAATGAGCTGCTGGGTGCCGGCATCGAGAAGGTGCAGGACCCGCAGACTGAGGACCGC
AGGCTGCAGCCCTCCACGCCTGAGAAGAAGGGTCTGTTCACGGTGACGCGGCTCTGTGACCTCTCAGTG
GAAGGGGACTCAGTGACCTCCGTGGGCTGGTCTGAGCGGGGGAACCTGGTGGCGGTGGGCACACACAAG
GGCTTCGTGCAGATCTGGGACGCAGCCGCAGGGAAGAAGCTGTCCATGTTGGAGGGCCACACGGCACGC
GTCGGGGCGCTGGCCTGGAATGCTGAGCAGCTGTCGTCCGGGAGCCGCGACCGCATGATCCTGCAGAGG
GACATCCGCACCCCGCCACTGCAGTCGGAGCGGCGGCTGCAGGGCCACCGGCAGGAGGTGTGCGGGCTC
AAGTGGTCCACAGACCACCAGCTCCTCGCCTCGGGGGGCAACGACAACAAGCTGCTGGTCTGGAATCAC
TCGAGCCTGAGCCCCGTGCAGCAGTACACGGAGCACCTGGCGGCCGTGAAGGCCATCGCCTGGTCCCCA
CATCAGCACGGGCTGCTGGCCTCGGGGGGCGGCACAGCTGACCGCTGTATCCGCTTCTGGAACACGCTG
ACAGGACAACCACTGCAGTGTATCGACACGGGCTCCCAAGTGTGCAATCTGGCCTGGTCCAAGCACGCC
AACGAGCTGGTGAGCACGCACGGCTACTCACAGAACCAGATCCTTGTCTGGAAGTACCCCTCCCTGACC
CAGGTGGCCAAGCTGACCGGGCACTCCTACCGCGTGCTGTACCTGGCAATGTCCCCTGATGGGGAGGCC
ATCGTCACTGGTGCTGGAGACGAGACCCTGAGGTTCTGGAACGTCTTTAGCAAAACCCGTTCGACAAAG
GAGTCTGTGTCTGTGCTCAACCTCTTCACCAGGATCCGGTAA

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001136197
Insert Size 1215 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001136197.1
RefSeq Size 3170 bp
RefSeq ORF 1215 bp
Locus ID 51343
UniProt ID Q9UM11
Protein Families Druggable Genome
Protein Pathways Cell cycle, Progesterone-mediated oocyte maturation, Ubiquitin mediated proteolysis
MW 44.9 kDa
Gene Summary Substrate-specific adapter for the anaphase promoting complex/cyclosome (APC/C) E3 ubiquitin-protein ligase complex. Associates with the APC/C in late mitosis, in replacement of CDC20, and activates the APC/C during anaphase and telophase. The APC/C remains active in degrading substrates to ensure that positive regulators of the cell cycle do not accumulate prematurely. At the G1/S transition FZR1 is phosphorylated, leading to its dissociation from the APC/C. Following DNA damage, it is required for the G2 DNA damage checkpoint: its dephosphorylation and reassociation with the APC/C leads to the ubiquitination of PLK1, preventing entry into mitosis. Acts as an adapter for APC/C to target the DNA-end resection factor RBBP8/CtIP for ubiquitination and subsequent proteasomal degradation. Through the regulation of RBBP8/CtIP protein turnover, may play a role in DNA damage response, favoring DNA double-strand repair through error-prone non-homologous end joining (NHEJ) over error-free, RBBP8-mediated homologous recombination (HR) (PubMed:25349192).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) skips multiple exons in the central coding region and lacks a short in-frame segment in the 3' coding region compared to variant 1. The encoded protein (isoform 3) lacks a WD40 repeat and has a shorter C-terminus compared to isoform 1. This isoform is also known as isoform beta.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...