SIRPB1 (NM_001135844) Human Untagged Clone
CAT#: SC325880
SIRPB1 (untagged)-Human signal-regulatory protein beta 1 (SIRPB1), transcript variant 3
CNY 3,656.00
CNY 6,460.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD172b; SIRP-BETA-1 |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001135844 edited
ATGCCCGTGCCAGCCTCCTGGCCCCACCTTCCTAGTCCTTTCCTGCTGATGACGCTACTG CTGGGGAGACTCACAGGGGTAGCTGGCGAGGAAGAGCTGCAGGTGATTCAGCCTGACAAG TCCATATCAGTTGCAGCTGGAGAGTCGGCCACTCTGCACTGCACTGTGACTTCCCTGATC CCTGTGGGGCCCATCCAGTGGTTCAGAGGAGCTGGACCAGGCCGGGAATTAATCTACAAT CAGAAAGAAGGCCACTTCCCACGGGTAACAACTGTTTCAGACCTCACAAAGAGAAACAAC ATGGACTTTTCCATCCGCATCAGTAACATCACCCCAGCAGATGCCGGCACCTACTACTGT GTGAAGTTCCGGAAAGGGAGCCCCGACCACGTGGAGTTTAAGTCTGGAGCAGGCACCGAG CTGTCTGTGCGTGCCAAACCCTCTGCCCCCGTGGTATCGGGCCCTGCGGCGAGGGCCACA CCTCAGCACACAGTGAGCTTCACCTGCGAGTCCCACGGCTTCTCACCCAGAGACATCACC CTGAAATGGTTCAAAAATGGGAATGAGCTCTCAGACTTCCAGACCAACGTGGACCCCGCA GGAGACAGTGTGTCCTACAGCATCCACAGCACAGCCAAGGTGGTGCTGACCCGCGAGGAC GTTCACTCTCAAGTCATCTGCGAGGTGGCCCACGTCACCTTGCAGGGGGACCCTCTTCGT GGGACTGCCAACTTGTCTGAGACCATCCGAGTTCCACCCACCTTGGAGGTTACTCAACAG CCCGTGAGGGCAGAGAACCAGGTGAATGTCACCTGCCAGGTGAGGAAGTTCTACCCCCAG AGACTACAGCTGACCTGGTTGGAGAATGGAAACGTGTCCAGGACAGAAACGGCCTCAACC CTTACAGAAAACAAGGATGGTACCTACAACTGGATGAGCTGGCTCCTGGTGAATGTATCT GCCCACAGGGATGATGTGAAGCTCACCTGCCAGGTGGAGCATGACGGGCAGCCAGCGGTC AGCAAAAGCCATGACCTGAAGGTCTCAGCCCACCCGAAGGAGCAGGGCTCAAATACTGCT CCTGGCCCAGCACTGGCTTCTGCTGCTCCACTTCTCATAGCTTTCCTCCTGGGCCCCAAG GTGCTGCTGGTGGTTGGTGTCTCTGTCATCTATGTCTACTGGAAGCAGAAGGCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001135844 |
Insert Size | 1200 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001135844.1, NP_001129316.1 |
RefSeq Size | 2241 bp |
RefSeq ORF | 1197 bp |
Locus ID | 10326 |
UniProt ID | Q5TFQ8 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | The protein encoded by this gene is a member of the signal-regulatory-protein (SIRP) family, and also belongs to the immunoglobulin superfamily. SIRP family members are receptor-type transmembrane glycoproteins known to be involved in the negative regulation of receptor tyrosine kinase-coupled signaling processes. This protein was found to interact with TYROBP/DAP12, a protein bearing immunoreceptor tyrosine-based activation motifs. This protein was also reported to participate in the recruitment of tyrosine kinase SYK. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009] Transcript Variant: This variant (3) differs in the 3' UTR and coding sequence compared to variant 1. The encoded isoform (3) is the same length as isoform 1, but these isoforms differ in their amino acid sequences. Both variants 3 and 4 encode the same isoform (3). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226750 | SIRPB1 (Myc-DDK-tagged)-Human signal-regulatory protein beta 1 (SIRPB1), transcript variant 3 |
CNY 3,656.00 |
|
RC226750L3 | Lenti ORF clone of Human signal-regulatory protein beta 1 (SIRPB1), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC226750L4 | Lenti ORF clone of Human signal-regulatory protein beta 1 (SIRPB1), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG226750 | SIRPB1 (tGFP-tagged) - Human signal-regulatory protein beta 1 (SIRPB1), transcript variant 3 |
CNY 4,370.00 |