BIGM103 (SLC39A8) (NM_001135148) Human Untagged Clone
CAT#: SC325871
SLC39A8 (untagged)-Human solute carrier family 39 (zinc transporter), member 8 (SLC39A8), transcript variant 4
CNY 6,370.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BIGM103; CDG2N; LZT-Hs6; PP3105; ZIP8 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001135148, the custom clone sequence may differ by one or more nucleotides
ATGCACCAACACGCTCAGTGTTTAACTGCTGAAGAGATCTTTTCCCTTCATGGCTTTTCA AATGCTACCCAAATAACCAGCTCCAAATTCTCTGTCATCTGTCCAGCAGTCTTACAGCAA TTGAACTTTCACCCATGTGAGGATCGGCCCAAGCACAAAACAAGACCAAGTCATTCAGAA GTTTGGGGATATGGATTCCTGTCAGTGACGATTATTAATCTGGCATCTCTCCTCGGATTG ATTTTGACTCCACTGATAAAGAAATCTTATTTCCCAAAGATTTTGACCTTTTTTGTGGGG CTGGCTATTGGGACTCTTTTTTCAAATGCAATTTTCCAACTTATTCCAGAGGCATTTGGA TTTGATCCCAAAGTCGACAGTTATGTTGAGAAGGCAGTTGCTGTGTTTGGTGGATTTTAC CTACTTTTCTTTTTTGAAAGAATGCTAAAGATGTTATTAAAGACATATGGTCAGAATGGT CATACCCACTTTGGAAATGATAACTTTGGTCCTCAAGAAAAAACTCATCAACCTAAAGCA TTACCTGCCATCAATGGTGTGACATGCTATGCAAATCCTGCTGTCACAGAAGCTAATGGA CATATCCATTTTGATAATGTCAGTGTGGTATCTCTACAGGATGGAAAAAAAGAGCCAAGT TCATGTACCTGTTTGAAGGGGCCCAAACTGTCAGAAATAGGGACGATTGCCTGGATGATA ACGCTCTGCGATGCCCTCCACAATTTCATCGATGGCCTGGCGATTGGGGCTTCCTGCACC TTGTCTCTCCTTCAGGGACTCAGTACTTCCATAGCAATCCTATGTGAGGAGTTTCCCCAC GAGTTAGGAGACTTTGTGATCCTACTCAATGCAGGGATGAGCACTCGACAAGCCTTGCTA TTCAACTTCCTTTCTGCATGTTCCTGCTATGTTGGGCTAGCTTTTGGCATTTTGGTGGGC AACAATTTCGCTCCAAATATTATATTTGCACTTGCTGGAGGCATGTTCCTCTATATTTCT CTGGCAGATATGTTTCCAGAGATGAATGATATGCTGAGAGAAAAGGTAACTGGAAGAAAA ACCGATTTCACCTTCTTCATGATTCAGAATGCTGGAATGTTAACTGGATTCACAGCCATT CTACTCATTACCTTGTATGCAGGAGAAATCGAATTGGAG |
Restriction Sites | Please inquire |
ACCN | NM_001135148 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001135148.1, NP_001128620.1 |
RefSeq Size | 2624 bp |
RefSeq ORF | 1182 bp |
Locus ID | 64116 |
UniProt ID | Q9C0K1 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a member of the SLC39 family of solute-carrier genes, which show structural characteristics of zinc transporters. The encoded protein is glycosylated and found in the plasma membrane and mitochondria, and functions in the cellular import of zinc at the onset of inflammation. It is also thought to be the primary transporter of the toxic cation cadmium, which is found in cigarette smoke. Multiple transcript variants encoding different isoforms have been found for this gene. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Oct 2008] Transcript Variant: This variant (4) has a distinct 5' exon, compared to variant 1. The resulting protein (isoform c) has a shorter and distinct N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225601 | SLC39A8 (Myc-DDK-tagged)-Human solute carrier family 39 (zinc transporter), member 8 (SLC39A8), transcript variant 4 |
CNY 3,656.00 |
|
RC225601L1 | Lenti-ORF clone of SLC39A8 (Myc-DDK-tagged)-Human solute carrier family 39 (zinc transporter), member 8 (SLC39A8), transcript variant 4 |
CNY 6,056.00 |
|
RC225601L2 | Lenti-ORF clone of SLC39A8 (mGFP-tagged)-Human solute carrier family 39 (zinc transporter), member 8 (SLC39A8), transcript variant 4 |
CNY 5,890.00 |
|
RC225601L3 | Lenti-ORF clone of SLC39A8 (Myc-DDK-tagged)-Human solute carrier family 39 (zinc transporter), member 8 (SLC39A8), transcript variant 4 |
CNY 5,890.00 |
|
RC225601L4 | Lenti-ORF clone of SLC39A8 (mGFP-tagged)-Human solute carrier family 39 (zinc transporter), member 8 (SLC39A8), transcript variant 4 |
CNY 5,890.00 |
|
RG225601 | SLC39A8 (tGFP-tagged) - Human solute carrier family 39 (zinc transporter), member 8 (SLC39A8), transcript variant 4 |
CNY 4,370.00 |
其它SLC39A8产品