CRF1 (CRHR1) (NM_001145147) Human Untagged Clone

CAT#: SC325841

CRHR1 (untagged)-Human corticotropin releasing hormone receptor 1 (CRHR1), transcript variant 3



  "NM_001145147" in other vectors (4)

CNY 6,080.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CRHR1 Antibody (N-Terminus)
    • 50 ug

CNY 5,654.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CRF-R; CRF-R-1; CRF-R1; CRF1; CRFR-1; CRFR1; CRH-R-1; CRH-R1; CRHR; CRHR1L
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325841 representing NM_001145147.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGAGGGCACCCGCAGCTCCGTCTCGTCAAGGCCCTTCTCCTTCTGGGGCTGAACCCCGTCTCTGCC
TCCCTCCAGGACCAGCACTGCGAGAGCCTGTCCCTGGCCAGCAACATCTCAGACAATGGCTACCGGGAG
TGCCTGGCCAATGGCAGCTGGGCCGCCCGCGTGAATTACTCCGAGTGCCAGGAGATCCTCAATGAGGAG
AAAAAAAGCAAGGTGCACTACCATGTCGCAGTCATCATCAACTACCTGGGCCACTGTATCTCCCTGGTG
GCCCTCCTGGTGGCCTTTGTCCTCTTTCTGCGGCTCAGGAGCATCCGGTGCCTGCGAAACATCATCCAC
TGGAACCTCATCTCCGCCTTCATCCTGCGCAACGCCACCTGGTTCGTGGTCCAGCTAACCATGAGCCCC
GAGGTCCACCAGAGCAACGTGGGCTGGTGCAGGTTGGTGACAGCCGCCTACAACTACTTCCATGTGACC
AACTTCTTCTGGATGTTCGGCGAGGGCTGCTACCTGCACACAGCCATCGTGCTCACCTACTCCACTGAC
CGGCTGCGCAAATGGATGTTCATCTGCATTGGCTGGGGTGTGCCCTTCCCCATCATTGTGGCCTGGGCC
ATTGGGAAGCTGTACTACGACAATGAGAAGTGCTGGTTTGGCAAAAGGCCTGGGGTGTACACCGACTAC
ATCTACCAGGGCCCCATGATCCTGGTCCTGCTGATCAATTTCATCTTCCTTTTCAACATCGTCCGCATC
CTCATGACCAAGCTCCGGGCATCCACCACGTCTGAGACCATTCAGTACAGGAAGGCTGTGAAAGCCACT
CTGGTGCTGCTGCCCCTCCTGGGCATCACCTACATGCTGTTCTTCGTCAATCCCGGGGAGGATGAGGTC
TCCCGGGTCGTCTTCATCTACTTCAACTCCTTCCTGGAATCCTTCCAGGGCTTCTTTGTGTCTGTGTTC
TACTGTTTCCTCAATAGTGAGGTCCGTTCTGCCATCCGGAAGAGGTGGCACCGGTGGCAGGACAAGCAC
TCGATCCGTGCCCGAGTGGCCCGTGCCATGTCCATCCCCACCTCCCCAACCCGTGTCAGCTTTCACAGC
ATCAAGCAGTCCACAGCAGTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001145147
Insert Size 1128 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001145147.1
RefSeq Size 2474 bp
RefSeq ORF 1128 bp
Locus ID 1394
UniProt ID P34998
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Long-term depression, Neuroactive ligand-receptor interaction
MW 43.3 kDa
Gene Summary This gene encodes a G-protein coupled receptor that binds neuropeptides of the corticotropin releasing hormone family that are major regulators of the hypothalamic-pituitary-adrenal pathway. The encoded protein is essential for the activation of signal transduction pathways that regulate diverse physiological processes including stress, reproduction, immune response and obesity. Alternative splicing results in multiple transcript variants. Naturally-occurring readthrough transcription between this gene and upstream GeneID:147081 results in transcripts that encode isoforms that share similarity with the products of this gene. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (1c, also known as CRH-R1c), lacks an alternate in-frame exon in both the 5' and central coding regions, compared to variant 1b. The encoded isoform (3) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...