VPS37A (NM_001145152) Human Untagged Clone

CAT#: SC325838

VPS37A (untagged)-Human vacuolar protein sorting 37 homolog A (S. cerevisiae) (VPS37A), transcript variant 2



  "NM_001145152" in other vectors (4)

CN¥ 6,080.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-VPS37A Antibody
    • 100 ul

CN¥ 1,999.00
CN¥ 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HCRP1; PQBP2; SPG53
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325838 representing NM_001145152.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCTGGCTTTTTCCCCTGACCAAGAGCGCCTCCTCCTCCGCGGCTGGGTCCCCCGGTGGCCTCACC
AGCCTCCAGCAGCAGAAGCAGCGCCTGATCGAGTCCCTCCGGAACTCACACTCCAGATTGCTTCCTCCA
CAGTTTCCTCAGGAAAAACCAGTGATCAGTGTTTATCCACCAATACGACATCACTTAATGGATAAACAA
GGAGTGTATGTTACCTCTCCATTAGTAAACAATTTTACAATGCACTCAGATCTTGGAAAAATTATTCAG
AGTCTGTTGGATGAGTTTTGGAAGAATCCTCCAGTTTTAGCTCCTACTTCAACAGCATTTCCTTATCTA
TACAGTAACCCAAGTGGGATGTCTCCTTATGCTTCTCAGGGTTTTCCATTTCTTCCTCCATATCCTCCA
CAAGAAGCAAACAGGAGTATCACTTCTTTATCTGTTGCTGACACTGTTTCTTCTTCAACAACAAGTCAT
ACCACAGCCAAGCCTGCCGCTCCTTCATTTGGTGTCCTTTCAAATCTGCCATTACCCATTCCCACAGTG
GATGCTTCAATACCGACAAGCCAAAATGGTTTTGGGTACAAGATGCCAGATGTCCCTGATGCATTTCCA
GAACTCTCAGAACTAAGTGTGTCACAACTCACAGATATGAATGAACAAGAGGAGGTATTACTAGAACAG
TTTCTGACTTTGCCTCAACTAAAACAAATTATTACCGACAAAGATGACTTAGTAAAAAGTATTGAGGAA
CTAGCAAGAAAAAATCTCCTTTTGGAGCCCAGCTTGGAAGCCAAAAGACAAACTGTTTTAGATAAGTAT
GAATTACTTACACAGATGAAGTCCACTTTCGAAAAGAAGATGCAAAGGCAGCATGAACTTAGTGAGAGC
TGTAGTGCAAGTGCCCTTCAGGCAAGATTGAAAGTAGCTGCACATGAAGCTGAGGAAGAATCTGATAAT
ATTGCAGAAGACTTCTTGGAGGGAAAGATGGAAATAGATGATTTTCTCAGTAGCTTCATGGAAAAGAGA
ACAATTTGCCACTGTAGAAGAGCCAAGGAAGAGAAACTTCAGCAGGCGATAGCAATGCACAGCCAATTT
CATGCTCCACTATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001145152
Insert Size 1119 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001145152.1
RefSeq Size 4510 bp
RefSeq ORF 1119 bp
Locus ID 137492
UniProt ID Q8NEZ2
Protein Pathways Endocytosis
MW 41.5 kDa
Gene Summary This gene belongs to the VPS37 family, and encodes a component of the ESCRT-I (endosomal sorting complex required for transport I) protein complex, required for the sorting of ubiquitinated transmembrane proteins into internal vesicles of multivesicular bodies. Expression of this gene is downregulated in hepatocellular carcinoma, and mutations in this gene are associated with autosomal recessive spastic paraplegia-53. A related pseudogene has been identified on chromosome 5. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (2) lacks an exon in the coding region compared to variant 1. The encoded isoform (2) is shorter but has the same N- and C-termini compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...