ELAVL4 (NM_001144776) Human Untagged Clone
CAT#: SC325831
ELAVL4 (untagged)-Human ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) (ELAVL4), transcript variant 4
CNY 5,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HUD; PNEM |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001144776, the custom clone sequence may differ by one or more nucleotides
ATGGAACAGATAATTAGCACCATGGAGCCTCAGGTGTCAAATGGTCCGACATCCAATACA AGCAATGGACCCTCCAGCAACAACAGAAACTGTCCTTCTCCCATGCAAACAGGGGCAACC ACAGATGACAGCAAAACCAACCTCATCGTCAACTATTTACCCCAGAATATGACCCAAGAA GAATTCAGGAGTCTCTTCGGGAGCATTGGTGAAATAGAATCCTGCAAACTTGTGAGAGAC AAAATTACAGGACAGAGTTTAGGGTATGGATTTGTTAACTATATTGATCCAAAGGATGCA GAGAAAGCCATCAACACTTTAAATGGACTCAGACTCCAGACCAAAACCATAAAGGTCTCA TATGCCCGTCCGAGCTCTGCCTCAATCAGGGATGCTAACCTCTATGTTAGCGGCCTTCCC AAAACCATGACCCAGAAGGAACTGGAGCAACTTTTCTCGCAATACGGCCGTATCATCACC TCACGAATCCTGGTTGATCAAGTCACAGGAGTGTCCAGAGGGGTGGGATTCATCCGCTTT GATAAGAGGATTGAGGCAGAAGAAGCCATCAAAGGGCTGAATGGCCAGAAGCCCAGCGGT GCTACGGAACCGATTACTGTGAAGTTTGCCAACAACCCCAGCCAGAAGTCCAGCCAGGCC CTGCTCTCCCAGCTCTACCAGTCCCCCAACCGGCGCTACCCAGGTCCACTTCACCACCAG GCTCAGAGGTTCAGGCTGGACAATTTGCTTAATATGGCCTATGGCGTAAAGAGGTTCTCC CCAATTACCATTGATGGAATGACAAGCCTTGTGGGAATGAACATCCCTGGTCACACAGGA ACTGGGTGGTGCATCTTTGTCTACAACCTGTCCCCCGATTCCGATGAGAGTGTCCTCTGG CAGCTCTTTGGCCCCTTTGGAGCAGTGAACAACGTAAAGGTGATTCGTGACTTCAACACC AACAAGTGCAAGGGATTCGGCTTTGTCACCATGACCAACTATGATGAGGCGGCCATGGCC ATCGCCAGCCTCAACGGGTACCGCCTGGGAGACAGAGTGTTGCAAGTTTCCTTTAAAACC AACAAAGCCCACAAGTCC |
Restriction Sites | Please inquire |
ACCN | NM_001144776 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001144776.1, NP_001138248.1 |
RefSeq Size | 1873 bp |
RefSeq ORF | 1101 bp |
Locus ID | 1996 |
UniProt ID | P26378 |
Protein Families | Druggable Genome |
Gene Summary | May play a role in neuron-specific RNA processing. Protects CDKN1A mRNA from decay by binding to its 3' UTR (By similarity). Binds to AU-rich sequences (AREs) of target mRNAs, including VEGF and FOS mRNA.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) differs in the 5' UTR and 5' coding region and uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (4) has a distinct N-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226936 | ELAVL4 (Myc-DDK-tagged)-Human ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) (ELAVL4), transcript variant 4 |
CNY 3,990.00 |
|
RC226936L3 | Lenti-ORF clone of ELAVL4 (Myc-DDK-tagged)-Human ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) (ELAVL4), transcript variant 4 |
CNY 5,890.00 |
|
RC226936L4 | Lenti-ORF clone of ELAVL4 (mGFP-tagged)-Human ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) (ELAVL4), transcript variant 4 |
CNY 5,890.00 |
|
RG226936 | ELAVL4 (tGFP-tagged) - Human ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) (ELAVL4), transcript variant 4 |
CNY 4,370.00 |