DC SIGN (CD209) (NM_001144894) Human Untagged Clone
CAT#: SC325823
CD209 (untagged)-Human CD209 molecule (CD209), transcript variant 6
CNY 5,800.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CDSIGN; CLEC4L; DC-SIGN; DC-SIGN1; hDC-SIGN |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001144894, the custom clone sequence may differ by one or more nucleotides
ATGAGTGACTCCAAGGAACCAAGACTGCAGCAGCTGGGCCTCCTGGTGTCCAAGGTCCCC AGCTCCATAAGTCAGGAACAATCCAGGCAAGACGCGATCTACCAGAACCTGACCCAGCTT AAAGCTGCAGTGGGTGAGCTCTCAGAGAAATCCAAGCTGCAGGAGATCTACCAGGAGCTG ACCCAGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGAAATCTAAGCTGCAGGAGATCTAC CAGGAGCTGACCCGGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGAAATCTAAGCTGCAG GAGATCTACCAGGAGCTGACCTGGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGAAATCT AAGATGCAGGAGATCTACCAGGAGCTGACTCGGCTGAAGGCTGCAGTGGGTGAGCTTCCA GAGAAATCTAAGCAGCAGGAGATCTACCAGGAGCTGACCCGGCTGAAGGCTGCAGTGGGT GAGCTTCCAGAGAAATCTAAGCAGCAGGAGATCTACCAGGAGCTGACCCGGCTGAAGGCT GCAGTGGGTGAGCTTCCAGAGAAATCTAAGCAGCAGGAGATCTACCAGGAGCTGACCCAG CTGAAGGCTGCAGTGGAACGCCTGTGCCACCCCTGTCCCTGGGAATGGACATTCTTCCAA GGAAACTGTTACTTCATGTCTAACTCCCAGCGGAACTGGCACGACTCCATCACCGCCTGC AAAGAAGTGGGGGCCCAGCTCGTCGTAATCAAAAGTGCTGAGGAGCAGAACTTCCTACAG CTGCAGTCTTCCAGAAGTAACCGCTTCACCTGGATGGGACTTTCAGATCTAAATCAGGAA GGCACGTGGCAATGGGTGGACGGCTCACCTCTGTTGCCCAGCTTCAAGCAGTATTGGAAC AGAGGAGAGCCCAACAACGTTGGGGAGGAAGACTGCGCGGAATTTAGTGGCAATGGCTGG AACGACGACAAATGTAATCTTGCCAAATTCTGGATCTGCAAAAAGTCCGCAGCCTCCTGC TCCAGGGATGAAGAACAGTTTCTTTCTCCAGCCCCTGCCACCCCAAACCCCCCTCCTGCG |
Restriction Sites | Please inquire |
ACCN | NM_001144894 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001144894.1, NP_001138366.1 |
RefSeq Size | 4196 bp |
RefSeq ORF | 1083 bp |
Locus ID | 30835 |
UniProt ID | Q9NNX6 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a C-type lectin that functions in cell adhesion and pathogen recognition. This receptor recognizes a wide range of evolutionarily divergent pathogens with a large impact on public health, including leprosy and tuberculosis mycobacteria, the Ebola, hepatitis C, HIV-1 and Dengue viruses, and the SARS-CoV acute respiratory syndrome coronavirus. The protein is organized into four distinct domains: a C-terminal carbohydrate recognition domain, a flexible tandem-repeat neck domain, a transmembrane region and an N-terminal cytoplasmic domain involved in internalization. This gene is closely related in terms of both sequence and function to a neighboring gene, CLEC4M (Gene ID: 10332), also known as L-SIGN. The two genes differ in viral recognition and expression patterns, with this gene showing high expression on the surface of dendritic cells. Polymorphisms in the neck region are associated with protection from HIV-1 infection, while single nucleotide polymorphisms in the promoter of this gene are associated with differing resistance and susceptibility to and severity of infectious disease, including rs4804803, which is associated with SARS severity. [provided by RefSeq, May 2020] Transcript Variant: This variant (6) lacks multiple exons in the coding region but maintains the reading frame, compared to variant 1. The encoded isoform (6) is shorter and lacks the transmembrane domain compared to isoform 1. Sequence Note: This record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227875 | CD209 (Myc-DDK-tagged)-Human CD209 molecule (CD209), transcript variant 6. Note: ORF is codon optimized |
CNY 3,656.00 |
|
RC227875L3 | Lenti-ORF clone of CD209 (Myc-DDK-tagged)-Human CD209 molecule (CD209), transcript variant 6. Note: ORF is codon optimized |
CNY 6,056.00 |
|
RC227875L4 | Lenti-ORF clone of CD209 (mGFP-tagged)-Human CD209 molecule (CD209), transcript variant 6. Note: ORF is codon optimized |
CNY 5,890.00 |
|
RG227875 | CD209 (tGFP-tagged) - Human CD209 molecule (CD209), transcript variant 6. Note: ORF is codon optimized |
CNY 4,370.00 |