OTUD5 (NM_001136159) Human Untagged Clone

CAT#: SC325804

OTUD5 (untagged)-Human OTU domain containing 5 (OTUD5), transcript variant 4



  "NM_001136159" in other vectors (4)

CNY 5,700.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal OTUD5 Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DUBA; MCAND
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325804 representing NM_001136159.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGGAGGATGGCGCCTGTCTCTTCCGGGCTGTAGCTGACCAGGTGTATGGAGACCAGGACATGCAT
GAGGTTGTGCGAAAGCATTGCATGGACTATCTGATGAAGAATGCCGACTACTTCTCCAACTATGTCACA
GAGGACTTTACCACCTACATTAACAGGAAGCGGAAAAACAATTGCCATGGCAACCACATTGAGATGCAG
GCCATGGCAGAGATGTACAACCGTCCTGTGGAGGTGTACCAGTACAGCACAGAACCCATCAACACATTC
CATGGGATACATCAAAACGAGGACGAACCCATTCGTGTTAGCTACCATCGGAATATCCACTATAATTCA
GTGGTGAATCCTAACAAGGCCACCATTGGTGTGGGGCTGGGCCTGCCATCATTCAAACCAGGGTTTGCA
GAGCAGTCTCTGATGAAGAATGCCATAAAAACATCGGAGGAGTCATGGATTGAACAGCAGATGCTAGAA
GACAAGAAACGGGCCACAGACTGGGAGGCCACAAATGAAGCCATCGAGGAGCAGGTGGCTCGGGAATCC
TACCTGCAGTGGTTGCGGGATCAGGAGAAACAGGCTCGCCAGGTCCGAGGCCCCAGCCAGCCCCGGAAA
GCCAGCGCCACATGCAGTTCGGCCACAGCAGCAGCCTCCAGTGGCCTGGAGGAGTGGACTAGCCGGTCC
CCGCGGCAGCGGAGTTCAGCCTCGTCACCTGAGCACCCTGAGCTGCATGCTGAATTGGGCATGAAGCCC
CCTTCCCCAGGCACTGTTTTAGCTCTTGCCAAACCTCCTTCGCCCTGTGCGCCAGGTACAAGCAGTCAG
TTCTCGGCAGGGGCCGACCGGGCAACTTCCCCCCTTGTGTCCCTCTACCCTGCTTTGGAGTGCCGGGCC
CTCATTCAGCAGATGTCCCCCTCTGCCTTTGGTCTGAATGACTGGGATGATGATGAGATCCTAGCTTCG
GTGCTGGCAGTGTCCCAACAGGAATACCTAGACAGTATGAAGAAAAACAAAGTGCACAGAGACCCGCCC
CCAGACAAGAGTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001136159
Insert Size 1050 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001136159.1
RefSeq Size 2426 bp
RefSeq ORF 1050 bp
Locus ID 55593
UniProt ID Q96G74
Protein Families Protease
Protein Pathways RIG-I-like receptor signaling pathway
MW 39.2 kDa
Gene Summary This gene encodes a member of the OTU (ovarian tumor) domain-containing cysteine protease superfamily. The OTU domain confers deubiquitinase activity and the encoded protein has been shown to suppress the type I interferon-dependent innate immune response by cleaving the polyubiquitin chain from an essential type I interferon adaptor protein. Cleavage results in disassociation of the adaptor protein from a downstream signaling complex and disruption of the type I interferon signaling cascade. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Oct 2008]
Transcript Variant: This variant (4) contains an alternate in-frame exon in the 5' coding region and uses a downstream start codon, compared to variant 1. The resulting protein (isoform c) has a shorter N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...