LDHAL6A (NM_001144071) Human Untagged Clone

CAT#: SC325782

LDHAL6A (untagged)-Human lactate dehydrogenase A-like 6A (LDHAL6A), transcript variant 2



  "NM_001144071" in other vectors (4)

CN¥ 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
LDHAL6A Antibody - C-terminal region
    • 100 ul

CN¥ 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LDH6A
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001144071, the custom clone sequence may differ by one or more nucleotides
ATGGCAACTATCAAGAGTGAACTTATTAAGAATTTCGCGGAAGAGGAGGCCATTCATCAC
AATAAGATCTCCATTGTAGGAACTGGATCGGTTGGTGTGGCTTGTGCTATCAGCATCTTA
TTAAAAGGTTTGAGTGATGAACTTGTCCTTGTGGATGTTGATGAAGGCAAACTGAAGGGT
GAGACAATGGATCTTCAACATGGCAGCCCTTTTATGAAAATGCCAAATATTGTCTCCAGC
AAAGATTACCTGGTCACTGCAAACTCCAATCTAGTGATTATCACAGCAGGTGCACGCCAG
AAAAAAGGAGAAACACGCCTTGATTTAGTCCAGCGAAATGTATCCATCTTTAAATTAATG
ATTCCCAATATTACCCAGTACAGTCCTCACTGCAAACTGCTTATTGTTACTAATCCAGTG
GATATCTTAACTTATGTAGCCTGGAAGTTGAGTGGATTTCCCAAAAACCGTGTTATTGGA
AGTGGTTGTAATCTGGACTCTGCTCGTTTTCGTTACTTTATTGGGCAAAGGCTTGGCATC
CACTCTGAAAGCTGTCATGGGCTGATCCTTGGAGAGCATGGCGACTCAAGTGTTCCTGTG
TGGAGTGGTGTGAACATTGCTGGCGTCCCTCTGAAGGATCTGAACCCAGATATAGGAACT
GATAAAGATCCTGAGCAGTGGGAAAATGTCCACAAAAAAGTGATTTCCAGTGGCTATGAG
ATGGTCAAAATGAAAGGTTATACTTCTTGGGGCATTAGCCTATCTGTAGCTGATTTAACA
GAAAGTATTTTGAAGAATCTTAGGAGAGTGCATCCAGTTTCTACCCTAAGTAAGGGCCTC
TATGGAATAAATGAAGACATATTCCTTAGTGTCCCATGTATCCTGGGAGAGAATGGTATC
ACAGACCTCATAAAAGTAAAACTGACTCTTGAAGAGGAGGCCTGCTTGCAAAAGAGTGCA
GAAACACTTTGGGAAATTCAGAAGGAGCTCAAGCTT
Restriction Sites Please inquire     
ACCN NM_001144071
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001144071.1, NP_001137543.1
RefSeq Size 1990 bp
RefSeq ORF 999 bp
Locus ID 160287
UniProt ID Q6ZMR3
Protein Pathways Cysteine and methionine metabolism, Glycolysis / Gluconeogenesis, Metabolic pathways, Propanoate metabolism, Pyruvate metabolism
Gene Summary Displays an lactate dehydrogenase activity. Significantly increases the transcriptional activity of JUN, when overexpressed.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The extent of this RefSeq transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...