LDB2 (NM_001130834) Human Untagged Clone

CAT#: SC325781

LDB2 (untagged)-Human LIM domain binding 2 (LDB2), transcript variant 2



  "NM_001130834" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
LDB2 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CLIM1; LDB-2; LDB1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325781 representing NM_001130834.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCCAGCACACCACATGACCCCTTCTATTCTTCTCCTTTCGGCCCATTTTATAGGAGGCATACACCA
TACATGGTACAGCCAGAGTACCGAATCTATGAGATGAACAAGAGACTGCAGTCTCGCACAGAGGATAGT
GACAACCTCTGGTGGGACGCCTTTGCCACTGAATTTTTTGAAGATGACGCCACATTAACCCTTTCATTT
TGTTTGGAAGATGGACCAAAGCGATACACTATCGGCAGGACCCTCATCCCCCGTTACTTTAGCACTGTG
TTTGAAGGAGGGGTGACCGACCTGTATTACATTCTCAAACACTCGAAAGAGTCATACCACAACTCATCC
ATCACGGTGGACTGCGACCAGTGTACCATGGTCACCCAGCACGGGAAGCCCATGTTTACCAAGGTATGT
ACAGAAGGCAGACTGATCTTGGAGTTCACCTTTGATGATCTCATGAGAATCAAAACATGGCACTTTACC
ATTAGACAATACCGAGAGTTAGTCCCGAGAAGCATCCTAGCCATGCATGCACAAGATCCTCAGGTCCTG
GATCAGCTGTCCAAAAACATCACCAGGATGGGGCTAACAAACTTCACCCTCAACTACCTCAGGTTGTGT
GTAATATTGGAGCCAATGCAGGAACTGATGTCGAGACATAAAACTTACAACCTCAGTCCCCGAGACTGC
CTGAAGACCTGCTTGTTTCAGAAGTGGCAGAGGATGGTGGCTCCGCCAGCAGAACCCACAAGGCAACCA
ACAACCAAACGGAGAAAAAGGAAAAATTCCACCAGCAGCACTTCCAACAGCAGCGCTGGGAACAATGCA
AACAGCACTGGCAGCAAGAAGAAGACCACAGCTGCAAACCTGAGTCTGTCCAGTCAGGTACCTGGGCTA
GGAGCGATCCCGAACTGCAGCCTCAACCCTGGGAGGGATGGAGACCTGTGTCATTCAACAGCAGTGACC
CCTTCTGGCCAATTTAAGGAGAAGCATTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001130834
Insert Size 996 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001130834.2
RefSeq Size 2698 bp
RefSeq ORF 996 bp
Locus ID 9079
UniProt ID O43679
MW 38 kDa
Gene Summary The protein encoded by this gene belongs to the LIM-domain binding family. Members of this family are characterized by a conserved nuclear localization sequence, an amino-terminal homodimerization domain and a carboxy-terminal LIM interaction domain. These proteins function as adapter molecules to allow assembly of transcriptional regulatory complexes. Genetic association studies suggest functions for this gene in rhegmatogenous retinal detachment and coronary artery disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Transcript Variant: This variant (2) contains an alternate exon in the 3' coding region and differs in the 3' UTR compared to variant 1. It encodes isoform b, which is shorter and has a distinct C-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...