MKRN1 (NM_001145125) Human Untagged Clone
CAT#: SC325775
MKRN1 (untagged)-Human makorin ring finger protein 1 (MKRN1), transcript variant 2
CNY 6,270.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RNF61 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC325775 representing NM_001145125.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGAGGCTGCAACTCCCGGAACAACAGCCACAACATCAGGAGCAGGAGCGGCAGCGGCGACGGCG GCAGCAGCCTCCCCCACCCCGATCCCCACAGTCACCGCCCCGTCCCTGGGGGCGGGCGGAGGGGGCGGC GGCAGCGACGGCAGCGGCGGCGGCTGGACTAAACAGGTCACCTGCAGGTATTTTATGCATGGGGTTTGT AAGGAAGGAGACAACTGTCGCTACTCGCATGACCTCTCTGACAGTCCGTATAGTGTAGTGTGCAAGTAT TTTCAGCGAGGGTACTGTATTTATGGAGACCGCTGCAGATATGAACATAGCAAACCATTGAAACAGGAA GAAGCAACTGCTACAGAGCTAACTACAAAGTCATCCCTTGCTGCTTCCTCAAGTCTCTCATCGATAGTT GGACCACTTGTTGAAATGAATACAGGCGAAGCTGAGTCAAGAAATTCAAACTTTGCAACTGTAGGAGCA GGTTCAGAGGACTGGGTGAATGCTATTGAGTTTGTTCCTGGGCAACCCTACTGTGGCCGTACTGCGCCT TCCTGCACTGAAGCACCCCTGCAGGGCTCAGTGACCAAGGAAGAATCAGAGAAAGAGCAAACCGCCGTG GAGACAAAGAAGCAGCTGTGCCCCTATGCTGCAGTGGGAGAGTGCCGATACGGGGAGAACTGTGTGTAT CTCCACGGAGATTCTTGTGACATGTGTGGGCTGCAGGTCCTGCATCCAATGGATGCTGCCCAGAGATCG CAGCATATCAAATCGTGCATTGAGGCCCATGAGAAGGACATGGAGCTCTCATTTGCCGTGCAGCGCAGC AAGGACATGGTGTGTGGGATCTGCATGGAGGTGGTCTATGAGAAAGCCAACCCCAGTGAGCGCCGCTTC GGGATCCTCTCCAACTGCAACCACACCTACTGTCTCAAGTGCATTCGCAAGTGGAGGAGTGCTAAGCAA TTTGAGAGCAAGATCATAAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001145125 |
Insert Size | 990 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001145125.1 |
RefSeq Size | 1686 bp |
RefSeq ORF | 990 bp |
Locus ID | 23608 |
UniProt ID | Q9UHC7 |
Protein Families | Druggable Genome |
MW | 35.2 kDa |
Gene Summary | This gene encodes a protein that belongs to a novel class of zinc finger proteins. The encoded protein functions as a transcriptional co-regulator, and as an E3 ubiquitin ligase that promotes the ubiquitination and proteasomal degradation of target proteins. The protein encoded by this gene is thought to regulate RNA polymerase II-catalyzed transcription. Substrates for this protein's E3 ubiquitin ligase activity include the capsid protein of the West Nile virus and the catalytic subunit of the telomerase ribonucleoprotein. This protein controls cell cycle arrest and apoptosis by regulating p21, a cell cycle regulator, and the tumor suppressor protein p53. Pseudogenes of this gene are present on chromosomes 1, 3, 9, 12 and 20, and on the X chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014] Transcript Variant: This variant (2) contains a 3' terminal exon that extends past a splice site that is used in variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226557 | MKRN1 (Myc-DDK-tagged)-Human makorin ring finger protein 1 (MKRN1), transcript variant 2 |
CNY 2,400.00 |
|
RC226557L3 | Lenti ORF clone of Human makorin ring finger protein 1 (MKRN1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC226557L4 | Lenti ORF clone of Human makorin ring finger protein 1 (MKRN1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG226557 | MKRN1 (tGFP-tagged) - Human makorin ring finger protein 1 (MKRN1), transcript variant 2 |
CNY 4,370.00 |