FKBP6 (NM_001135211) Human Untagged Clone

CAT#: SC325770

FKBP6 (untagged)-Human FK506 binding protein 6, 36kDa (FKBP6), transcript variant 2



  "NM_001135211" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


FKBP6 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FKBP36
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325770 representing NM_001135211.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGTGCCTCCTCGTGGCCCCAGAATGGAATGCCGCCGTCGTCCCTGTACGAGCGGTTAAGTCAGAGG
ATGCTGGACATCTCGGGGGACCGGGGCGTGCTGAAGGACGTCATCCGAGAAGGAGCTGGAGACCTAGTG
GCGCCTGATGCTTCGGTGCTAGTGAAATACTCGGGATACCTGGAACACATGGACAGACCCTTCGATTCT
AATTACTTTAGGAAAACTCCTCGGCTAATGAAACTTGGAGAGGATATTACACTGTGGGGCATGGAGCTG
GGCCTTCTGAGCATGCGGAGAGGAGAGCTGGCCAGGTTTCTGTTCAAACCGAACTACGCCTATGGAACG
CTGGGCTGCCCTCCCTTGATCCCCCCAAACACCACTGTCCTGTTTGAGATTGAGCTGCTTGACTTCCTG
GACTGTGCTGAGTCAGACAAGTTTTGTGCTCTCTCAGCTGAGCAGCAAGACCAATTTCCACTTCAGAAG
GTCCTGAAAGTGGCAGCTACGGAACGGGAGTTTGGCAACTACCTTTTCCGCCAGAATCGTTTCTATGAT
GCCAAAGTGAGATATAAAAGGGCCCTATTGCTTCTGCGCCGGCGATCAGCACCCCCTGAAGAGCAGCAC
CTGGTGGAGGCCGCCAAGCTTCCTGTTCTCCTGAACCTGTCCTTTACATACCTGAAGCTAGACCGACCC
ACCATAGCCCTGTGCTATGGAGAGCAGGCTTTGATCATTGACCAAAAGAATGCCAAGGCCCTCTTCAGG
TGTGGACAGGCTTGTCTTCTCCTGACTGAGTATCAAAAGGCCCGGGATTTTCTAGTTCGAGCCCAGAAG
GAGCAACCCTTCAATCATGACATCAATAATGAGCTGAAGAAACTGGCTAGCTGTTACAGGGACTATGTG
GATAAAGAGAAAGAAATGTGGCACCGCATGTTCGCGCCCTGTGGCGATGGTTCTACAGCAGGAGAAAGT
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001135211
Insert Size 969 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001135211.2
RefSeq Size 1549 bp
RefSeq ORF 969 bp
Locus ID 8468
UniProt ID O75344
MW 36.9 kDa
Gene Summary The protein encoded by this gene is a cis-trans peptidyl-prolyl isomerase that may function in immunoregulation and basic cellular processes involving protein folding and trafficking. This gene is located in a chromosomal region that is deleted in Williams-Beuren syndrome. Defects in this gene may cause male infertility. There are multiple pseudogenes for this gene located nearby on chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate upstream start codon, compared to variant 1. The encoded isoform (b) is shorter and has a distinct N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...