United States
Germany
Japan
United Kingdom
China
Caspase 5 (CASP5) (NM_001136110) Human Untagged Clone
CAT＃: SC325722
CASP5 (untagged)-Human caspase 5, apoptosis-related cysteine peptidase (CASP5), transcript variant c
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ICE(rel)III; ICEREL-III; ICH-3 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001136110, the custom clone sequence may differ by one or more nucleotides
ATGGCTGCTCTTCTGCAAATCGAGGCTGGACCACCTGAGTCAGCAGAATCTACAAATATA CTCAAACTTTGTCCTCGTGAAGAATTCCTGAGACTGTGTAAAAAAAATCATGATGAGATC TATCCAATAAAAAAGAGAGAGGACCGCAGACGCCTGGCTCTCATCATATGCAATACAAAG TTTGATCACCTGCCTGCAAGGAATGGGGCTCACTATGACATCGTGGGGATGAAAAGGCTG CTTCAAGGCCTGGGCTACACTGTGGTTGACGAAAAGAATCTCACAGCCAGGGATATGGAG TCAGTGCTGAGGGCATTTGCTGCCAGACCAGAGCACAAGTCCTCTGACAGCACGTTCTTG GTACTCATGTCTCATGGCATCCTAGAGGGAATCTGCGGAACTGCGCATAAAAAGAAAAAA CCGGATGTGCTGCTTTATGACACCATCTTCCAGATATTCAACAACCGCAACTGCCTCAGT CTAAAGGACAAACCCAAGGTCATCATTGTCCAGGCCTGCAGAGGTGAAAAACATGGGGAA CTCTGGGTCAGAGACTCTCCAGCATCCTTGGCACTCATCTCTTCACAGTCATCTGAGAAC CTGGAGGCAGATTCTGTTTGCAAGATCCACGAGGAGAAGGACTTCATTGCTTTCTGTTCT TCAACACCACATAACGTGTCCTGGAGAGACCGCACAAGGGGCTCCATCTTCATTACGGAA CTCATCACATGCTTCCAGAAATATTCTTGCTGCTGCCACCTAATGGAAATATTTCGGAAG GTACAGAAATCATTTGAAGTTCCACAGGCTAAAGCCCAGATGCCCACCATAGAACGAGCA ACCTTGACAAGAGATTTCTACCTCTTTCCTGGCAAT |
| Restriction Sites | Please inquire |
| ACCN | NM_001136110 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001136110.1, NP_001129582.1 |
| RefSeq Size | 1023 bp |
| RefSeq ORF | 879 bp |
| Locus ID | 838 |
| UniProt ID | P51878 |
| Protein Families | Druggable Genome, Protease |
| Protein Pathways | NOD-like receptor signaling pathway |
| Gene Summary | This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. Overexpression of the active form of this enzyme induces apoptosis in fibroblasts. Max, a central component of the Myc/Max/Mad transcription regulation network important for cell growth, differentiation, and apoptosis, is cleaved by this protein; this process requires Fas-mediated dephosphorylation of Max. The expression of this gene is regulated by interferon-gamma and lipopolysaccharide. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Aug 2010] Transcript Variant: This variant (c) is lacking two consecutive in-frame coding exons compared to transcript variant a, resulting in a shorter isoform (c) missing a 142 aa protein segment compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227816 | CASP5 (Myc-DDK-tagged)-Human caspase 5, apoptosis-related cysteine peptidase (CASP5), transcript variant c |
CNY 2,400.00 |
|
| RC227816L3 | Lenti-ORF clone of CASP5 (Myc-DDK-tagged)-Human caspase 5, apoptosis-related cysteine peptidase (CASP5), transcript variant c |
CNY 5,890.00 |
|
| RC227816L4 | Lenti-ORF clone of CASP5 (mGFP-tagged)-Human caspase 5, apoptosis-related cysteine peptidase (CASP5), transcript variant c |
CNY 5,890.00 |
|
| RG227816 | CASP5 (tGFP-tagged) - Human caspase 5, apoptosis-related cysteine peptidase (CASP5), transcript variant c |
CNY 4,370.00 |
其它Caspase 5产品
