ALS2CR1 (NIF3L1) (NM_001142356) Human Untagged Clone

CAT#: SC325711

NIF3L1 (untagged)-Human NIF3 NGG1 interacting factor 3-like 1 (S. pombe) (NIF3L1), transcript variant 4



  "NM_001142356" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


NIF3L1 mouse monoclonal antibody, clone OTI3E1 (formerly 3E1)
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ALS2CR1; CALS-7; MDS015
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325711 representing NM_001142356.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTGTCATCTTGCGTACGCCCAGTCCCCACGACAGTCCGGTTTGTAGATTCCCTGATCTGCAATTCT
TCCCGTTCCTTCATGGATTTGAAGGCTCTCCTTTCTTCCTTGAATGACTTTGCATCCCTCTCGTTTGCT
GAGAGTTGGGACAATGTTGGATTACTGGTGGAACCAAGCCCACCACATACTGTAAATACACTCTTCCTG
ACCAATGACCTGACTGAGGAAGTGATGGAGGAGGTGCTGCAAAAGAAGGCAGACCTCATTCTCTCCTAC
CATCCGCCTATCTTCCGACCCATGAAGCGCATAACCTGGAACACATGGAAGGAGCGCCTGGTGATCCGG
GCTCTGGAGAACAGAGTCGGTATCTACTCTCCTCATACAGCCTATGATGCTGCGCCCCAGGGCGTCAAC
AACTGGTTGGCTAAAGGGCTTGGAGCTTGTACCTCCAGGCCCATACATCCTTCCAAAGCTCCCAACTAC
CCTACAGAGGGAAACCACCGAGTAGAATTCAACGTTAACTACACCCAAGACCTGGACAAAGTCATGTCT
GCAGTGAAAGGAATTGACGGTGTTTCTGTCACTTCTTTTTCTGCTAGGACTGGTAATGAGGAACAAACA
CGGATTAATCTGAATTGTACTCAGAAGGCTTTGATGCAGGTGGTAGATTTTCTTTCCCGGAACAAACAA
CTTTATCAGAAGACGGAAATTCTGTCACTGGAGAAGAGTCTCAAGTCAAAGTCGTGGCCCTGTGTGCTG
GTTCTGGGAGCAGCGTTCTGCAGGGTGTTGAGGCTGACCTTTACCTCACAGGTGAGATGTCCCATCATG
ATACTTTGGATGCTGCTTCCCAAGGAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001142356
Insert Size 858 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001142356.1
RefSeq Size 1293 bp
RefSeq ORF 858 bp
Locus ID 60491
UniProt ID Q9GZT8
MW 32.2 kDa
Gene Summary May function as a transcriptional corepressor through its interaction with COPS2, negatively regulating the expression of genes involved in neuronal differentiation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) differs in the 5' UTR and lacks an alternate exon in the 3' coding region, compared to variant 1, resulting in a frameshift. The encoded isoform (3) has a distinct C-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...