RNASEH2B (NM_001142279) Human Untagged Clone

CAT#: SC325676

RNASEH2B (untagged)-Human ribonuclease H2, subunit B (RNASEH2B), transcript variant 2



  "NM_001142279" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
RNASEH2B Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AGS2; DLEU8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325676 representing NM_001142279.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCGCTGGCGTGGACTGCGGGGACGGGGTTGGCGCCCGGCAGCACGTGTTCCTGGTTTCAGAATAT
TTAAAAGATGCTTCAAAGAAGATGAAAAATGGGCTAATGTTTGTAAAACTGGTTAACCCCTGTTCAGGA
GAAGGAGCCATTTACTTGTTCAATATGTGTCTACAGCAGCTGTTTGAAGTAAAAGTTTTCAAGGAAAAA
CACCATTCTTGGTTTATAAATCAATCAGTTCAATCAGGAGGTCTTCTCCATTTTGCCACACCTGTGGAT
CCTCTATTTCTGCTTCTCCACTACCTCATAAAGGCTGATAAGGAGGGGAAGTTTCAGCCCCTTGATCAA
GTTGTGGTGGATAACGTGTTTCCAAATTGCATCTTGTTGCTGAAACTTCCTGGACTTGAGAAGTTACTT
CATCATGTGACAGAGGAAAAAGGTAATCCAGAAATAGACAACAAGAAATATTACAAGTACAGCAAAGAG
AAGACATTAAAGTGGCTGGAAAAAAAGGTTAATCAAACTGTGGCAGCATTAAAAACCAATAATGTGAAT
GTCAGTTCCCGGGTACAGTCAACTGCATTTTTCTCTGGTGACCAAGCTTCCACTGACAAGGAAGAGGAT
TATATTCGTTATGCCCATGGTCTGATATCTGACTACATCCCTAAAGAATTAAGTGATGACTTATCTAAA
TACTTAAAGCTTCCAGAACCTTCAGCCTCATTGCCAAATCCTCCATCAAAGATGGCAGCACAAAGACAG
AAAAGGGGCAAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001142279
Insert Size 774 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001142279.2
RefSeq Size 1685 bp
RefSeq ORF 774 bp
Locus ID 79621
UniProt ID Q5TBB1
Protein Pathways DNA replication
MW 29 kDa
Gene Summary RNase H2 is composed of a single catalytic subunit (A) and two non-catalytic subunits (B and C) and specifically degrades the RNA of RNA:DNA hybrids. The protein encoded by this gene is the non-catalytic B subunit of RNase H2, which is thought to play a role in DNA replication. Multiple transcript variants encoding different isoforms have been found for this gene. Defects in this gene are a cause of Aicardi-Goutieres syndrome type 2 (AGS2). [provided by RefSeq, Nov 2008]
Transcript Variant: This variant (2) uses an alternate splice pattern in the 3' coding region, compared to variant 1. The resulting protein (isoform 2) has a shorter and distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...